Entry information : PpalKat01 (PpalKatE)
Entry ID 8408
Creation 2011-05-29 (Marcel Zamocky)
Last sequence changes 2011-05-29 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-05-30 (Christophe Dunand)
Peroxidase information: PpalKat01 (PpalKatE)
Name (synonym) PpalKat01 (PpalKatE)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Polysphondylium
Organism Polysphondylium pallidum (Cellular slime mold)    [TaxId: 13642 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpalKat01
start..stop
S start..stop
DpuKat01 889 0 1..496 1..496
DdKat01 875 0 1..496 1..496
NgrKat01 690 0 6..482 13..486
TthKat01 677 0 5..485 9..484
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 202680..203064 385 N° 2 203165..203222 58 N° 3 203315..204321 1007 N° 4 204390..204430 41
join(202680..203064,203165..203222,203315..204321,204390..204430)


exon

Literature and cross-references PpalKat01 (PpalKatE)
Literature Gloeckner G., Schaap P., Noegel A.A., Felder M., Eichinger L., Heidel A.J., Platzer M. Living fossils from the dawn of multicellularity.
(unpublished since 2009)

Protein ref. GenBank:   EFA82574.1 UniProtKB:   D3B731
DNA ref. GenBank:   ADBJ01000018.1 (202680..204430)
Protein sequence: PpalKat01 (PpalKatE)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   496
PWM (Da):   %s   55723.95  
PI (pH):   %s   9.15
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSQPILTTSNGAPVDNNLNSITAGNPGPILLQDFHLIDKLSHFDRERIPERVVHAKGAGAHGYFEVVNADLPKWCRAKFLNKVGKRTPIFTRFSTVGGEKGSADSERDPRGFAVKFYTEEGNWDMVGNNTPVFFIRDPSKFPDFIHTQKRNPQTNLKDPNAFWDFASLTPESTHQFTVLFSDRGTPKSYRHMDGFSSHTLKWVNQQGKQYWVKLHFKTETGIQNWNAEEAGKLAGSDPDSATRDLFETIANGGEPAWKVYIQLMEYDDAFKYRFDPFDVTKVWSHKDYPLIPIGRMVLNRNPENYFAEVEQAAFSPSHLVPGIEPSLDKMLQGRLFSYPDTHRHRLGVNYQQIPINCPYAVKGGLKNYQRDGQMAVNGNGGKGPNYHPNSFGGPEVLPEAGIAKYNISGVVGRQKYQHPNDDFVQPGDLYRLMDEGAKSRLVSNIVGHMKGVSVREIQLRAINNFYRADKDYGTRIAKGLGIINDVIKSNAKSNL

Retrieve as FASTA  
Remarks complete sequence from genomic (3 introns). Strain="PN500" (Clade 3 catalase binding NADPH).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCACAACCAATTTTAACAACATCAAACGGTGCACCCGTTGATAACAATCTCAACTCAATTACCGCTGGTAACCCAGGTCCAATCTTGCTTCAAGACTTCCACTTGATCGACAAGTTG
TCACACTTTGACCGTGAACGTATTCCAGAGCGTGTTGTACATGCCAAGGGTGCTGGTGCACATGGTTACTTTGAGGTTGTCAACGCTGACCTCCCAAAGTGGTGTCGTGCAAAGTTCTTG
AATAAGGTCGGAAAGCGTACTCCAATCTTTACCCGTTTCTCGACTGTCGGTGGTGAGAAGGGTTCTGCTGACTCTGAACGTGATCCACGTGGTTTCGCTGTTAAGTTCTACACTGAGGAG
GGTAACTGGGATATGGTTGGTAACA
GTAAGTAGTTTAACACCTTTTAAATAACATACAAATCAAATCAAATCAAAACATAAACAATTCTAATACTTTGTTTACTTTTACCTACAAATATA
AATAGACACTCCAGTCTTCTTCATTCGTGACCCATCAAAGTTCCCAGATTTCATTCACACCCAGTAAGTTTCTTCATTGTCTTTTTATCACCTAACTTTTCAAATCAAACTTTACTAATT
AAACTATTATTATTGCTATTGTTATTATTTAATAGAAAGCGTAATCCACAAACCAATTTGAAGGATCCAAATGCATTCTGGGATTTCGCTAGTTTGACACCAGAATCAACTCACCAATTC
ACAGTTTTGTTCTCTGACAGAGGTACTCCAAAGTCCTATCGTCATATGGATGGTTTCTCATCACACACCTTGAAGTGGGTCAACCAACAAGGAAAGCAATACTGGGTTAAATTGCACTTC
AAGACTGAGACTGGTATTCAAAACTGGAATGCTGAGGAAGCCGGTAAGCTCGCTGGTTCCGACCCAGACTCTGCTACCCGTGATCTCTTTGAGACCATTGCCAACGGTGGTGAGCCAGCC
TGGAAGGTCTACATCCAATTGATGGAGTATGACGACGCTTTCAAATACCGTTTCGATCCATTCGATGTCACCAAGGTCTGGTCGCACAAGGACTACCCATTGATCCCAATCGGTCGTATG
GTCTTGAACCGTAACCCAGAGAACTACTTTGCCGAAGTCGAGCAAGCTGCCTTCTCGCCATCCCACTTAGTTCCAGGTATCGAACCATCGTTGGACAAGATGCTCCAAGGTCGTCTCTTC
TCATACCCAGATACCCACCGTCACCGTCTCGGTGTCAACTACCAACAGATCCCAATCAACTGTCCATACGCCGTCAAGGGTGGTCTCAAGAACTACCAACGTGATGGTCAGATGGCTGTC
AACGGTAACGGTGGTAAGGGTCCAAACTACCATCCAAACAGCTTCGGTGGTCCAGAGGTCCTCCCAGAGGCCGGTATTGCCAAGTACAACATCTCTGGTGTTGTCGGTCGTCAAAAGTAT
CAACATCCAAACGACGATTTCGTTCAACCAGGTGATCTCTACCGTTTAATGGACGAGGGTGCCAAGTCTCGTTTGGTCTCCAACATCGTTGGACACATGAAGGGTGTATCCGTTCGTGAG
ATCCAACTCCGTGCCATCAACAATTTCTACAGAGCCGACAAGGACTATGGTACCAGAATTGCCAAAGGACTTGGTATTGATA
GTAAGTTTTATTTATTTTTTTCAAACAAAGTTATTTAA
ATACTAATATCATATTTTTTTTTTTTTTAGTTAACGATGTAATTAAATCCAATGCTAAATCCAACTTGTAA

Retrieve as FASTA