Entry information : SbPrx31 (Sobic.002G234200.1 [2.1] / SB02G027330 [1,4])
Entry ID 841
Creation 2006-01-02 (Christophe Dunand)
Last sequence changes 2011-01-21 (Toky Ramarohetra)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx31 (Sobic.002G234200.1 [2.1] / SB02G027330 [1,4])
Name (synonyms) SbPrx31 (Sobic.002G234200.1 [2.1] / SB02G027330 [1,4])
Class Class III peroxidase    [Orthogroup: Prx018]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Callus
Cell culture
Leaves
Inducer Drought
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx31
start..stop
S start..stop
ZmPrx10 605 0 1..337 1..335
SiPrx121 585 0 14..332 11..328
TmPrx07 556 0 26..329 22..325
TaPrx15 556 0 26..329 22..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 62543180..62543410 231 N° 2 62542840..62543031 192 N° 3 62538484..62539083 600  
complement(join(62538484..62539083,62542840..62543031,62543180..62543410))


exon

Literature and cross-references SbPrx31 (Sobic.002G234200.1 [2.1] / SB02G027330 [1,4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chromosome_2 (62543410..62538484)
Protein sequence: SbPrx31 (Sobic.002G234200.1 [2.1] / SB02G027330 [1,4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   340 (313)
PWM (Da):   %s   37185.61 (34312.1)  
PI (pH):   %s   6.29 (5.52) Peptide Signal:   %s   cut: 28 range:28-340
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVPRGCLLRLLAVAVFLAFLCCRGEAAVRELKVGYYAETCPEAEDIVRETMARARAREARSVASVMRLQFHDCFVNGCDGSVLMDATPTMPGEKEALSNIDSLRSFEVVDEIKEALEERCPGVVSCADIVIMAARDAVVLTGGPNWEVRLGRDDSLTASQEDSDNIMPSPRANASSLIRLFAGLNLSVTDLVALSGSHSIGEARCFSIVFRLYNQSGSGRPDPHMDAAYRRALEALCPKGGNEEVTGGLDATPRVFDNQYFKDLVALRGFLNSDQTLFSDNARTRRVVKQFSKNQDAFFRAFIEGMIKMGELQNPRKGEIRRNCRVANCSPVAPRVVDI*

Retrieve as FASTA  
Remarks Complete sequence from genemic (chromo 2, introns 1 and 2) and 3 ESTs (3'is missing) + 8 ESTs (5'is missing).
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CTACAGTCCT ACGAACAGAG TAGTGGATGC TTCGTTTCTG CGTAAGTTTG ACGCCATACC ATTTTAGAGG CAGTGTGATG AGTTGGCGTT TCCACTTTGG AGGGAGAAGA TGCGGCCACC  AAGAACTGCT GCTGCCTGCT GCACTTGGAA ACACTTTTGT GTGTAGCATT TTGATGAGAG AACGTGGTAA GCTGCATGGG CCACAAATAA GTCGCATGTT TTGCAAGTGA TATGATATCA  TTGCATATTA TGAGGAATCA CATTGACTAT GGTGTACCGT GTACTGGTGA AACTTTCTAG ACCGGGATAA GATAAAGAAC GAAAGCGATC ACGTACACTA AATTCTCTCA AGGGCACTGG  TAGTGCGGTT GGAATAGGCT CCGTTCGTTT GTTTGTATTT TTTTTAATCA GCAGTGTTTT TTCTCTTATA ATAAATCAAT GAACAGTATT TTCAGTTATG ACTTTTCAGA CAAGCGTTGG  AAACCTACAT AATATCCTTG TATTGTATTC TACCAGATCA TGGACCAGAA AGTTTGAGAT TACCCAAGAA TGATGATGCA AAGACACAAA CCTCGTTCGT TTGTCTTATA GGATATATTT  TTTCTGCAAG CCAGCAGTGT TTTTCTCTCA TAATAAATCA GCAAATGGTA TTTTTAGTCA TGACTTTTCT CACAATAGAT CAAAGCGGAG ATATATTTCC AAAGCAAACG TTATCATGAT  AAGCCTATAT TTTAAGCTAT ATCCGTTAAG ACAGGATATA ATTGTGATAA AGAGAAGACC AACGATTATA AACTTGCGAC AAAATCATGA TGATAGTACA CGATATGGAG TAGTTATTAT  GTCTATCAAG ACATGGTATA AATGTCATAA GCAGAAGACC GACGATTTTG AACTTGTGAT AAATTAAGGG TGATACATGA TTAAGATCAA TATGATATTA TGCTACACTG AAACTTAGAT  TATTCCTACC AGCTATGTAC TCTTTCCGTA TAGTATTTAG AAGTCGTTTT GGACAGGGTT TGAGTTAAAC ATTGAGAATA TAAATCATCA ATAACTTTTA AATTGTTGAA TTTGCAAATG  TAAAACTTAT ATGAATAGAT TTGTCTTGAA AAATGCTTTC ATAAATATAT ACATATCATT TTTTCTAAAT AAATAAAAGA TCAAAGTTAT GTTTCGGAGA CTATATCGCC GTTCTAAATA  ACTTATAAAA AAAAGCCCTC CTTTATCAAC GATCCGGATA AATGCAGAAT CTCATGCGCA TTTTTTTTTC ACCACATATC ATTCCTCCCA CCATTCACAC CTTTGACCAG AATAAGTAAT  CCCTGTTCTT TTTCACATTT CCAAAATGCC AGCAAAACTC AAATACAACC GTCCACATAC AGTGACACAC AGAGACGGCC ACACAAAAAG TCCGGCTCGA TGCTCCCTCC TCCCCTGCCG  GCCAATAATC GGCCGTGCCA TCATCATCTT CCACCGCGAC ACGGAGCGCG GATATTTTTG ACGCGCGCAC GCGCACCAAC GTGAACGCGA GCACCGCGTG TGACCGAAGC CGTCGTCGCG  CCCGGCCGGC GCGTTCTAGT GGTGTACGTA CAGTGTACTG GTTGGTCTCG GTGGTGTAGT AGGAACGGCG CCTGGCGCAG CCTACGCGAG CCGACCCCCG GCCGGCCGCG CGCTGGAGGC  TGGCGCCCGT GCTCACGCCG TCCGCCCACC ACTGGCTGGC CACAGCTCCC CGTGTCGCGC ACGGCCCCCC GCGCCCTCCT CTCCAACCCC GTGCTCACAG CTCATTGGCC TCCCCGCCTG  CAGCCAGCGG CCAGCCGTGG CCTCGCGAGT TGGACGCTAC TAGTACGGTG CCAAACAGCC GAGCAGAGGG CGAGGGCGAA GTGCAGTGCG GTGCAGTGTG ACCCGTCTCG TCTCGGAACA 
GCCGCGGACC ACCACCAGAG TCCAGAGCCG CAGAGCGCAG AGCGTGGCGT CCTTGCGCCC CACCCCACCC TCTCTCTATC C 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGTCCCCCGCGGATGCCTCCTCCGCCTGCTCGCCGTCGCCGTGTTCCTCGCGTTCCTCTGCTGCCGCGGCGAGGCGGCGGTGAGGGAGCTCAAGGTCGGGTACTACGCGGAGACG
TGCCCGGAGGCGGAGGACATCGTCCGCGAGACCATGGCGCGCGCGCGGGCACGCGAGGCCCGCAGCGTCGCCTCCGTCATGCGCCTCCAGTTCCACGACTGCTTCGTCAAC
GTGAGCCGA
TCGCCTGCCCAATCCCACGCATCTGATTCTGATCTCGCTCCGGTTGCACTACTACGTGGCTTCCCTTCCTTCCGTAGTCGATCTGACGCGATTGATTCACTCTGTTCCTTCCCGGTGGCG
GGGCCGGGGGCGGCTGCAGGGGTGCGACGGCTCCGTGCTGATGGACGCCACGCCGACGATGCCCGGCGAGAAGGAGGCGCTGTCCAACATCGACTCCCTGCGCTCGTTCGAGGTCGTCGA
CGAGATCAAGGAGGCGCTGGAGGAGCGCTGCCCCGGCGTCGTCTCCTGCGCCGACATCGTCATCATGGCCGCCCGCGACGCCGTTGTCCTG
GTACACGCGCCTCCCCCTCGCACCCAGCA
GAGATCCATTGCTCTGTTCACTTCGCCGGATATATGCGATGCCGATGCGCATGCCGTTTCTCTTAAATCTCTTATTACTGCGGCCTGCCGTTTGCTGTGCGAAACCCAGCGTTTCGCCTC
CGCTTTGTCTGCCGTTTCCGGTTCAAATCCGCGTTTCCTTTGTCTGCCGTTTGCACTCCCGAATCCAGCGTTTCGCTGGCTGGGCGTTTCCACTGCAGAACTCGGCGTTGATCGTGCTCC
CCGCAGGCCGCAGCATTCAGTTTCAGGATCCACCGTGAATTGCTTTGCCACCACGGCAGCGCTGCCTGCACGGGTGCTTCGTGCTGCTCGACAGCCAAACCAGGGCGGCGTGTGCCGCAC
AAGGCCTTTGCACCACTAGCTTCGTGTCGCGCTCTTCGGAACGCCTTTCGTGCCACTGGCCTCGCGTCGCGTTCGGCTTCCAAAACCTGGGTCTAATGTTCACGTACAAAATGGGCATTT
GTCCGCACGTATGGTAGGTGCCACCCCGTCACTTTGCGTGTGGGCACCACGAGTCCACGACCAAGCAGCAAGCATGCATTCCGTTTTACTCTGTCCCGCTCGCTTTGAACTTATCAGCGC
ACCTTTTCATGAAACAATATTTTTTCTTTTATTATAACAAATTAGCATTAGCATGAGACTTTTTTCAGCTAGTAAGGCCTTGTTTAGTTCACCCAAAAATAATTTTTTTTTTCAAGATTT
TTTGTCACATCGAATCTCACGGCACATGCATGGAACATTAAATATAGATAAAAACAAAAACTAATTGCACAGTTTACCTGTAAATCACGAGACGAATCTTTTAAGTTTAGTTACTCTATA
ATTGGATAATGTTTATTAAATAAAAACGAAAGTGCTATAATGTTAAAATCCAAAAACTTTTCGGATCTAAACAAGGTAAGTATAATGTTTACCTACTTGCTGGAAATGCTTCATTAGTTT
CAATGTATAGTATAGTCGTACTATTTTTTTATCCTTGTTTAGTTCCCAAAAAATTTTGCAAAAATTTTCATATTCTCCATCACATCGAATCTTTAGACGCATGCATGAAGTATTAAATAT
AGACGAAAATAAAAACTAATTACACAGCTTGGTCGAAATTGACGAGACGAATCTTTTGAGTCTAGTTAGTTCATAATTGGATAATATTTGTCAAATACTATTCCTATTTTGCAAAAAAAT
TTGGAAGTAAACAAGGGCTAGGAAAAAAATCAATTGATGCTTTCAAAATTTACAACAAATACATTTGTGCAAATTGGCAGACTGGTTCATAATCATTTACCTAGCAGGCTAGCACTGACC
ATGTTGCCTGGCGATGCATGAACGGTGCACATCCCAGTGCTCGCTGTAACCGCCGCCGCGGCGGCGGGCATGAGGCGCACATGCAGGACTGGCATCGCGACCTCTCAAACCACCAGACCA
CCTCCTCCCTCATGTCATGGCCATAGGCAGACTGCAGACAGGGAGAGCGCTAGAGACGGCCAGACCAGACCAGGTGCACGCCCCAGCCGGGAAAGGCCAGGCCCGAGCCGCCGCGCGCAC
GACACGTGAGTGTTGCTAGGCTTCGGCGTTTAGCGCGGACAGCCGTACCGGGCCCCGCGGGTGCTGCCACTAGCGCCGCGAATGGCAAAGCTGCCGGCCCCTCCGTCGCCGAGGTGGGAT
TCTGTTTCTCCCAGATTGGGCGATGATGGGGACGAGATTTCCCGTGGAACAGAGTACTTTTTGCGTGCTTTCCCTTGGTCCTCACGAAGGTTCGAATCGCGGCGTGGAAACAAGCGACGA
TGCCCATGCGCCCATGCCCCTGAATCCCTGATCGTTGATACCTGGGTGACTCCCAGCCTGGGACGCTGGGTGTACTACGACTACGACTCTACGAGTCTACGATTGCCCAAGGATACGGAC
ATATGGTTTGCTCTTCTTGTTCCCTTGGCGAGTAGGCAGTCGACAGGTGGTTCAACGGGATTGATTGTTGGTGCAGGAGATACTGTATCCTAGTATAGGAGTACTACTACGTAACGTACG
TACTACTAGTACAAAACCTGTCGATGTTCGTTGGGACTGTTTGCTTCCTAGCCTCAATGCGGCATGGCAAACTGTGGCAGAGTGTGGGCGAGGGGGGAAAAGCAACGTCATAGCCGCGGC
AAGATTTTGGGTCCTTTTTAACCTGCTTTTGCTTTTGTAAAAGCTAAAAGCCACAAGTGCTTTTGTCCAAAAACATCTTTTCTCGTAGTACAAATTCAAAAGCACCTCACCCCCTGCTTT
CACTGACTTTTGGGATCCGTTCAGTTACGAGTGACCAACCAAATGACTTTTGGGTTTCTCAAAGCCCACATCCCACAGCAGCTTTTCAAAAGCTCAAAGCTCACAGTAGCTTTTCCAAAA
GTCACAGCCCAACCAAACTCACCCTTTATGCTAGAGCCGTCCGTGGCTGTGGACGTAAATCTCAAAGCTTGTTAGCTTGTTGGGCTCGTGGCTGGTTTGGCTCAACTCGGCTAGATTTTA
GCTCGTTAGTTATAACGAGCCAACTCACGAGCCTAACGAGTTACAATATTAGAGAAAAAAGCAACATAACTTATACTAGTTTTGTATTACTTTATGTCTTACTCTTTATAAATGGTTGAT
ATGTTAGCTTATATGAATATTTTGTTGGACTTAAGACAATTAGATATATTATTATTGTATTATTACTATCTTTAAGCTTTAGATAAATATAAATATTATATTTTATATACCTGACTCGCG
AGCTTAACGACCTAGCTCGAGCTTTTAACGAGCCGAGCCGAGCTAGCTCGTTATTCTAACGAGCTAAAACGAGCCAAGCTGGCTCGTTATCCAGCCTTAGTCACAGCTTTTTACTCTGTT
CGCTTGAGCTTATCTATCAAATTTTACAGCCATTCAATAATATTTTTTTCTCACAATAAATCAATAAACAATACTTTCAACCATAACTTTTTAGCCAAACGAACAACCGACTTAAGTGCG
GCGTGCCACAGGTGATCATAGCATGGAACCAAACACCAATGTACTATACTTGCAACTCAAATATTGGTTCATCAAAAAAATTCCCATAAACGTATTTCCTTCTAAGAAAATGGTCGTAGT
ATACTCAGCTTAATTTGTGTCTGGGTGTGGCACGTTGTGGGCCTGTAAACTTAGTCGTGCACTTTTGTTTTGTTTCTTTTTTTTGTGTGGCAAAGACAAGCGAGATTAAGAATACTGCGC
CATCCATCACCATCATTATCATTAAATGCTTTCTCCGTCCAAAAAAAATTGCAATTCTCATATTATAAGGAGCCCACCAGTCCAAAGTTTAACTAAAATAATATGAAAAAGTACTAACAC
TCACGAGACAAACTATATACTTACTTAGTCAAACCTAAGCTCATTTGACTGACGCGATTTCTATAATTACATTCTTTTGCGGAGTAGTAATTTGCATTGTCTTACTAATATATCTGATGT
TGGACCTACTCTCTCCATCCAAAAAGAATGGAAGTCTCAATTAAAATAATCTTAAATTTAACTAATAAGTTTATAAAAGATAAGAGATAGTAATATTATACTTCAAATAGATTTATTACC
AAGATTTTGTGATTACTCTACTACTTACTGCGCGTATAAATATTAATAATATTTATTTTGTATATGCGTATTCAAACTTGAGACGGGTCAGGTTCTTTGAGTTCATCTAACTCTTCCATT
GTCACAGACCGGTGGGCCCAACTGGGAGGTGCGTCTCGGGCGCGATGACAGCCTGACGGCGAGCCAGGAGGACTCGGATAACATCATGCCGAGCCCGCGCGCCAACGCGAGCTCTCTCAT
CCGCCTCTTCGCGGGGCTCAACCTCAGCGTCACCGACCTCGTCGCGCTCTCGGGCTCGCACTCCATCGGCGAGGCCCGCTGCTTCTCCATCGTCTTCCGCCTCTACAACCAGTCCGGATC
CGGCCGCCCGGACCCCCACATGGACGCCGCCTACCGCCGCGCGCTCGAGGCGCTCTGCCCGAAGGGCGGCAACGAGGAGGTCACGGGAGGCCTGGACGCCACCCCGCGCGTCTTCGACAA
CCAGTACTTCAAGGACCTCGTCGCGCTCCGCGGCTTCCTCAACTCCGACCAGACGCTCTTCTCTGACAACGCCAGGACTCGCCGCGTCGTCAAGCAGTTCAGCAAGAACCAGGACGCCTT
CTTCAGAGCATTCATCGAGGGGATGATCAAGATGGGGGAGCTGCAGAACCCCCGGAAAGGGGAGATACGGCGCAACTGCCGCGTTGCTAACTGCTCGCCGGTGGCGCCCCGAGTCGTCGA
CATCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGTCCCCCGCGGATGCCTCCTCCGCCTGCTCGCCGTCGCCGTGTTCCTCGCGTTCCTCTGCTGCCGCGGCGAGGCGGCGGTGAGGGAGCTCAAGGTCGGGTACTACGCGGAGACG
TGCCCGGAGGCGGAGGACATCGTCCGCGAGACCATGGCGCGCGCGCGGGCACGCGAGGCCCGCAGCGTCGCCTCCGTCATGCGCCTCCAGTTCCACGACTGCTTCGTCAAC
GGGTGCGAC
GGCTCCGTGCTGATGGACGCCACGCCGACGATGCCCGGCGAGAAGGAGGCGCTGTCCAACATCGACTCCCTGCGCTCGTTCGAGGTCGTCGACGAGATCAAGGAGGCGCTGGAGGAGCGC
TGCCCCGGCGTCGTCTCCTGCGCCGACATCGTCATCATGGCCGCCCGCGACGCCGTTGTCCTG
ACCGGTGGGCCCAACTGGGAGGTGCGTCTCGGGCGCGATGACAGCCTGACGGCGAGC
CAGGAGGACTCGGATAACATCATGCCGAGCCCGCGCGCCAACGCGAGCTCTCTCATCCGCCTCTTCGCGGGGCTCAACCTCAGCGTCACCGACCTCGTCGCGCTCTCGGGCTCGCACTCC
ATCGGCGAGGCCCGCTGCTTCTCCATCGTCTTCCGCCTCTACAACCAGTCCGGATCCGGCCGCCCGGACCCCCACATGGACGCCGCCTACCGCCGCGCGCTCGAGGCGCTCTGCCCGAAG
GGCGGCAACGAGGAGGTCACGGGAGGCCTGGACGCCACCCCGCGCGTCTTCGACAACCAGTACTTCAAGGACCTCGTCGCGCTCCGCGGCTTCCTCAACTCCGACCAGACGCTCTTCTCT
GACAACGCCAGGACTCGCCGCGTCGTCAAGCAGTTCAGCAAGAACCAGGACGCCTTCTTCAGAGCATTCATCGAGGGGATGATCAAGATGGGGGAGCTGCAGAACCCCCGGAAAGGGGAG
ATACGGCGCAACTGCCGCGTTGCTAACTGCTCGCCGGTGGCGCCCCGAGTCGTCGACATCTGA

Retrieve as FASTA