Entry information : CgraKat02 (CgraKatE2)
Entry ID 8415
Creation 2011-06-01 (Marcel Zamocky)
Last sequence changes 2011-06-01 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-06-07 (Christophe Dunand)
Peroxidase information: CgraKat02 (CgraKatE2)
Name (synonym) CgraKat02 (CgraKatE2)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Glomerella
Organism Colletotrichum graminicola (Glomerella graminicola)    [TaxId: 31870 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CgraKat02
start..stop
S start..stop
CpurKat02 1024 0 1..715 2..714
GzKat03 998 0 1..715 1..715
CgKat02 992 0 1..715 1..704
CthedisKat2 985 0 18..715 22..722
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 678771..679055 285 N° 2 679119..679321 203 N° 3 679374..679469 96 N° 4 679533..679677 145
N° 5 679727..680089 363 N° 6 680145..680352 208 N° 7 680400..681247 848  
join(678771..679055,679119..679321,679374..679469,679533..679677,679727..680089, 680145..680352,680400..681247)


exon

Literature and cross-references CgraKat02 (CgraKatE2)
Literature Vaillancourt L. et al. The genome sequence of Glomerella graminicola. Unpublished since 2009
Protein ref. UniProtKB:   E3Q851
DNA ref. GenBank:   GG697336.1 (678771..681247)
Protein sequence: CgraKat02 (CgraKatE2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   715 (697)
PWM (Da):   %s   77289.24 (75508.3)  
PI (pH):   %s   6.65 (6.61) Peptide Signal:   %s   cut: 19 range:19-715
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHTTLLLAGLSLATLSSAGCPFADPSNIKARAEGGGSRSHVAANEIDDLSGDPFLTSDVGGPIGDQVSLKAGVRGSTLLEDFIFRQKITHFDHERVPERAVHARGAGAYGTFTSYGDFSNLTAAYFLSAAGKNTSTFVRFSTVAGSRGSSDTARDVHGFATRFFTDQGNFDIVGNNIPVFFIQDAIQFPDLVHAVKPRGDNEIPQAATAHDSAWDFFSSQTSSLHTLFWAMAGYGIPRSYRHDGFGVHTFRMVTNDGKSKLIKWHWKTLQGKASLVWEEAQIVSGKNADYHRQDLFDAIASGNGPEWELAVQVIDESDVLKFGFDLLDPTKIVPVELAPLQKLGKMKLDANPVNYFAETEQIMFQPGHIVRGIDFTEDPLLQGRIFSYLDTQLNRHGGPNFEQLPINRPVTPIHNNNRDGAAQNFIHRNRNSYFPNALNKNVPKQASQAEGNGFFTTPGRAVGGTLVRDISGTFADHWSQPRLFYNSLTPIEQQFLVNAIRFETSHIESPDVKNNVVVQLNKISNEVAGRVADALGIVKPAPDPQFYNNNTTQGITIFGEKLPTIATLKVGVLASLAADGSVVQGKQLKDAFAPSGVIVTIVGERLGNGVDMTYSQADATAFDGIIVTNGAQGLFDGTIKPSALYPAGRPAQMVIDSYRWGKPVGSIGKPLPDTAVLGVRPGAGVFASPDINVVVAGFKDGLATFRFTDRFAMD

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns). Strain="M1.001". No EST found.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATACGACCCTCTTGCTGGCCGGTCTCAGCCTGGCAACTCTTTCTTCTGCGGGTTGTCCCTTTGCAGATCCCTCCAACATCAAAGCCCGAGCCGAAGGTGGCGGCTCCCGCTCGCAT
GTCGCGGCCAACGAAATCGACGACCTTTCGGGCGACCCGTTCCTCACATCCGACGTCGGCGGTCCCATAGGGGACCAGGTGAGCTTGAAGGCCGGCGTCCGAGGTTCGACTCTGCTCGAG
GACTTCATCTTCCGCCAGAAGATTACCCACTTCGACCACGAGAGA
GTACGTCGCGGGATACCCTCGCTCCCTTGACCATCCATCCTGATTGACCCTCTTTACCCCTAGGTGCCTGAGCGA
GCCGTCCATGCCCGAGGTGCCGGTGCTTACGGCACCTTTACGAGCTACGGCGACTTCAGCAACCTCACTGCCGCTTATTTTCTGAGTGCCGCGGGCAAGAACACATCCACCTTTGTGCGG
TTTTCTACCGTTGCTGGTTCCAGAGGAAGCTCCGATACGGCGAGAGATGTGCATGGCTTCGCCACTAGATT
GTGGGTATTTGCTTGCGTGAGGTGCTGTAGCATGGACTGATGTTGACGA
CAGCTTCACCGACCAGGGAAACTTTGACATTGTGGGAAACAACATTCCCGTCTTTTTCATCCAGGACGCTATCCAGTTCCCAGACTTGGTCCACGCAGTGTAGGAGCTTATACGGCCCAC
CTCGCCCAGCCTAGACGTTAGCTCACAACATGACTCTCATAGGAAACCGCGCGGCGACAATGAGATCCCCCAGGCCGCCACGGCCCACGACTCTGCGTGGGACTTCTTCAGCTCTCAGAC
CAGCTCCCTTCACACCTTGTTCTGGGCGATGGCCGGCTACGGCATCCCGAGGAGCTATCGACACATG
GTGGGTTCACTCCTCGCTCACTTCACCCCACATTGGCTAATGCTGTCAGGACG
GCTTCGGCGTGCACACCTTCCGCATGGTAACGAACGACGGCAAATCCAAGCTCATCAAGTGGCACTGGAAGACGCTGCAGGGCAAGGCCAGCTTGGTCTGGGAGGAGGCTCAAATCGTTT
CTGGAAAGAACGCCGACTACCACCGCCAGGATCTCTTTGACGCCATTGCATCGGGTAATGGCCCCGAGTGGGAGCTCGCAGTTCAGGTTATCGACGAGTCGGACGTTCTCAAGTTCGGTT
TCGACCTCTTGGACCCCACCAAGATTGTGCCCGTGGAGCTCGCGCCCCTCCAGAAGCTTGGTAAGATGAAGCTGGATGCCAACCCTGTCAACTACTTTGCCGAGACTGAGCAGATCATG
G
TACGTCACCCTCCTCCCCCGAGCCTCGGACGCAACCGCAGCTGACCCGTGGCAGTTCCAACCCGGACACATCGTCAGGGGCATCGATTTCACCGAGGACCCCCTGCTGCAGGGCCGCATT
TTCTCGTACCTAGACACTCAGCTCAACCGTCACGGCGGGCCCAACTTTGAGCAGCTGCCGATCAACCGCCCGGTCACACCCATCCACAACAACAACCGAGACGGCGCCGCCCAGAACTTC
ATCCATCGCAACCGAAACTCCT
GTTCGTGGTCATTCCAAGCTCCCATCGGGCCTCGCTAACCGGGACAGACTTTCCAAACGCCCTGAACAAGAACGTACCTAAACAGGCGAGCCAGGCCG
AAGGCAACGGTTTCTTCACGACGCCAGGGCGCGCCGTCGGCGGCACCCTGGTCCGCGACATCTCCGGCACTTTCGCGGACCACTGGTCCCAGCCGCGTCTCTTCTACAACTCCCTGACGC
CCATCGAGCAGCAGTTCCTCGTCAATGCCATCCGCTTCGAGACCAGCCACATCGAGTCGCCCGACGTCAAGAACAACGTCGTCGTTCAGCTCAACAAGATCTCCAACGAGGTTGCAGGCC
GCGTTGCTGACGCCCTGGGTATCGTAAAGCCGGCGCCCGACCCGCAGTTCTACAACAACAACACCACCCAAGGCATCACCATCTTCGGCGAGAAGCTGCCCACCATCGCCACTCTGAAGG
TCGGTGTGCTAGCGAGTCTGGCGGCCGACGGCTCCGTGGTTCAGGGCAAGCAGTTGAAGGACGCCTTCGCCCCCAGCGGCGTCATAGTGACCATCGTCGGCGAGAGGTTGGGCAACGGCG
TCGACATGACATACTCCCAGGCAGACGCCACCGCGTTTGACGGCATCATCGTCACCAATGGCGCGCAGGGCCTGTTTGACGGAACTATCAAGCCATCTGCGCTGTACCCGGCAGGCCGCC
CGGCGCAGATGGTCATCGACTCGTATAGATGGGGCAAGCCCGTCGGCAGTATCGGCAAGCCCCTGCCCGATACGGCCGTGCTCGGGGTCAGGCCCGGCGCAGGCGTCTTTGCGTCCCCAG
ACATCAACGTGGTGGTAGCCGGTTTCAAGGATGGCCTGGCTACGTTCAGATTCACCGACCGCTTCGCGATGGACTAG

Retrieve as FASTA