Entry information : CpurKat02 (CpurKatE2)
Entry ID 8416
Creation 2011-06-01 (Marcel Zamocky)
Last sequence changes 2011-06-01 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-06-07 (Christophe Dunand)
Peroxidase information: CpurKat02 (CpurKatE2)
Name (synonym) CpurKat02 (CpurKatE2)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Clavicipitaceae Claviceps
Organism Claviceps purpurea (ergot fungus)    [TaxId: 5111 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CpurKat02
start..stop
S start..stop
GzKat03 1097 0 1..714 1..715
CgraKat02 1024 0 2..714 1..715
CgKat02 1015 0 4..714 6..704
CthedisKat2 995 0 19..714 22..722
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1670..1957 288 N° 2 2036..2238 203 N° 3 2360..2600 241 N° 4 2671..3033 363
N° 5 3122..3329 208 N° 6 3398..4245 848  
join(1670..1957,2036..2238,2360..2600,2671..3033,3122..3329,3398..4245)


exon

Literature and cross-references CpurKat02 (CpurKatE2)
Literature Garre V., Mueller U., Tudzynski P. Cloning, characterization and targeted disruption of cpcat1, coding for an in planta secreted catalase of Claviceps purpurea. (Unpublished since 1998).
Protein ref. GenBank:   CAA04716.1 UniProtKB:   O60038
DNA ref. GenBank:   AJ001386.1 (1670..4245)
Protein sequence: CpurKat02 (CpurKatE2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   716 (697)
PWM (Da):   %s   78599.71 (76782.7)  
PI (pH):   %s   6.72 (6.64) Peptide Signal:   %s   cut: 20 range:20-716
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVRTSLAAFSLAVAGLASAQCPFADPGRLAARAQGLDESSRGHLAGFEVDDSEGYLTSDVGGPIEDQNSLKAGDRGPTLLEDFIFRQKITHFDHERVPERAVHARGTGAHGTFTSYGDYSNITAASFLGQKDKKTPVFVRFSTVAGSRGSADTARDVHGFAVRLYTDEGNFDIVGNNVPVFFIQDAIQFPDLIHSVKPRQDNEIPQAATAHDSAWDFFSQQTSTLHTLFWAMAGYGIPRSLRHDGFGVHTYRLVTDDGTSKLVKWHWKSKQGKASLVWDEAQRAAGKNADYHRQDLFDAIQSGNYPEWELNLQIINEDQALAFGFDVLDPTKIIPEEYAPLMPVGVMRLDANPSNYFAETEQVMFQPGHIVRGVDFTEDPLLQGRIFSYLDTQINRHGGPNFEQLPINRPVVPIHNNNRDGAGQNFIHKNNAPYTPNTLNKGFPKQANQKEGKGFFTAPGRKVSGSLQRRLSNTFLDHWTQPRLFFNSITPIEQQFLINAIRFETSHLSQVVQKNVLAQLNKISHDVAVRVGKALGLDAPPADDKYYHNNQTKGLSIFGEELPTIATLIVGVLASTASKNSLAQAQALKDAFKTREVNVIVVAESLATGVDQTYDAADAVSFDGIVVADGVEALFDNTKKSSLFQPGRPSQIVNDGYNWGKPMGFLGSAKRAVKATSVVEGAGVYMRNSTATLVGDFQKGLAKFKFTDRFPMDTK

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns). Strain="T5". No EST found.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGCGAACTTCGCTAGCTGCCTTCTCCCTGGCAGTCGCCGGCCTGGCCAGCGCACAATGCCCCTTCGCAGACCCAGGACGTCTTGCCGCAAGAGCTCAGGGCCTAGATGAATCGTCC
AGAGGCCATCTGGCTGGTTTCGAAGTCGACGACAGCGAGGGCTACCTGACGTCCGACGTCGGTGGCCCAATCGAGGATCAGAACAGTCTCAAAGCCGGGGACCGAGGCCCTACACTGCTG
GAAGATTTTATTTTCCGACAGAAAATCACCCATTTTGACCACGAGCGA
GTAAGTGATGACCAGGTGGAAGCGTATGACGGTCATGGCAGGGAATAACAAGAGGCTGACACACCGTGTCCA
ACACAGGTTCCCGAAAGAGCTGTTCACGCCCGAGGAACAGGCGCCCACGGCACCTTCACCAGCTACGGCGATTATAGCAATATCACCGCAGCCTCATTTTTGGGCCAAAAGGACAAGAAG
ACGCCCGTATTTGTTCGTTTCTCCACTGTAGCGGGCTCTCGTGGAAGTGCGGACACAGCTCGTGACGTGCACGGATTTGCCGTTCGATT
GTGAGTTGATATCATCGGCGACCATACACTA
CCTAATCTAGTCTCAACGGCTTGTGAGCACGAGACTGTGATGTGCAAGAAAGACAATCGTCCATGCTGACCAGTGCTGCTTCGTTGACAGGTATACCGACGAAGGAAACTTCGATATCGT
GGGCAACAATGTTCCTGTGTTCTTCATTCAGGATGCTATCCAATTCCCCGATCTTATCCATTCGGTCAAGCCACGCCAGGACAATGAGATCCCACAGGCTGCCACTGCTCACGACTCAGC
GTGGGACTTCTTCTCGCAACAGACGTCGACTCTGCACACTTTGTTCTGGGCCATGGCTGGTTATGGTATCCCACGTAGTTTGCGCCACATG
GTACGTCATGCGACACGGCTTCTGATGTC
ATATGTGCTCGTGAGATTCTGGAGCTAATTCTTGAGGACAGGACGGTTTTGGTGTACACACATACCGACTCGTTACCGATGATGGCACGTCCAAGCTGGTAAAGTGGCACTGGAAGTCTA
AGCAGGGCAAAGCCAGTCTAGTTTGGGATGAGGCCCAGCGCGCCGCCGGCAAGAATGCCGACTACCACAGACAGGATCTCTTCGACGCCATCCAGTCGGGCAACTATCCCGAGTGGGAGC
TCAACCTGCAAATCATCAACGAGGATCAAGCCCTAGCCTTTGGATTCGACGTGCTCGATCCTACCAAGATCATTCCTGAGGAATATGCCCCTCTGATGCCGGTCGGTGTCATGAGACTCG
ATGCCAATCCTTCCAACTATTTTGCTGAGACTGAACAAGTCATG
GTATGTCTTTCAATCCTCGACCAAAGACTGTTGCGAAAGAAAAGCTTCAGTTAGGGAAATCCGTTTGCTTACCAAC
TTCAATTAACAGTTCCAACCTGGCCATATTGTGCGAGGCGTCGACTTCACGGAGGACCCTCTGCTGCAGGGCCGCATCTTCTCGTACCTGGATACTCAAATTAACAGACACGGTGGCCCC
AACTTTGAGCAGCTTCCCATCAACAGGCCTGTCGTTCCTATTCACAACAACAATCGCGATGGAGCTGGCCAGAATTTCATTCATAAGAACAATGCTCCTT
GTAAGCGCCTCTTGCCCCTG
TTCCAACCAAATATCATAATTCGACTCAATCTAACACCTTCTTACAAGATACCCCCAACACTCTGAACAAGGGATTTCCCAAGCAAGCCAACCAGAAGGAAGGCAAGGGCTTTTTCACCG
CTCCCGGACGCAAGGTCTCTGGCTCCCTGCAACGGCGTCTCAGCAACACGTTCCTTGATCACTGGACCCAGCCCCGTCTATTCTTCAACTCCATCACGCCTATCGAGCAGCAGTTCTTGA
TTAATGCGATCCGCTTCGAAACCTCGCACCTCAGCCAGGTTGTGCAGAAGAACGTCCTCGCGCAGCTCAACAAGATCAGCCACGATGTTGCCGTCCGCGTCGGCAAGGCTCTTGGCCTGG
ACGCACCCCCCGCAGATGACAAGTACTACCACAACAACCAGACCAAGGGCCTGTCCATCTTTGGCGAGGAGCTGCCCACCATCGCTACCCTCATCGTCGGCGTCTTGGCCTCTACTGCAT
CCAAAAACTCGCTGGCCCAGGCCCAGGCCCTCAAGGACGCCTTCAAAACCAGGGAGGTCAACGTCATCGTGGTGGCTGAATCCCTCGCCACCGGTGTGGACCAGACATACGACGCCGCCG
ACGCAGTCAGCTTCGACGGCATCGTTGTCGCCGACGGAGTCGAGGCCCTCTTTGACAACACCAAGAAATCCTCGCTCTTCCAGCCTGGTCGTCCTAGCCAAATCGTAAACGACGGATACA
ACTGGGGCAAACCCATGGGATTCCTCGGCAGCGCCAAGAGGGCCGTTAAGGCGACTTCTGTGGTGGAGGGTGCCGGTGTGTACATGAGAAACAGCACGGCTACTCTGGTGGGAGACTTCC
AGAAGGGGCTTGCCAAGTTCAAGTTTACGGACCGGTTCCCTATGGACACTAAATAA

Retrieve as FASTA