Entry information : CgraKat01 (CgraKatE1)
Entry ID 8418
Creation 2011-06-01 (Marcel Zamocky)
Last sequence changes 2011-06-01 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-06-07 (Christophe Dunand)
Peroxidase information: CgraKat01 (CgraKatE1)
Name (synonym) CgraKat01 (CgraKatE1)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Glomerella
Organism Colletotrichum graminicola (Glomerella graminicola)    [TaxId: 31870 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CgraKat01
start..stop
S start..stop
PanKat01 1121 0 1..742 1..736
MgrKat01 1118 0 8..742 10..743
NcKat01 1118 0 1..742 1..736
NhaeKat01 1111 0 1..742 1..738
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 230506..230733 228 N° 2 230786..231107 322 N° 3 231164..232842 1679  
join(230506..230733,230786..231107,231164..232842)


exon

Literature and cross-references CgraKat01 (CgraKatE1)
Literature Vaillancourt L, et al. (unpublished since 2009)
Protein ref. GenBank:   EFQ32851.1 UniProtKB:   E3QPS4
DNA ref. GenBank:   GG697365.1 (230506..232842)
Protein sequence: CgraKat01 (CgraKatE1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   742
PWM (Da):   %s   82857.89  
PI (pH):   %s   6.62
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSNILPATLKKAGNVVMGQSNKKNAQLAENMVEPNPKAPMTTDFGTKIENTDDWLRVTNNDKTGPTLLEDAIAREKIHRFDHERIPERVVHARGAGAFGTFRLFESASDVTNAGILTDTSRETPLFLRFSTVLGSRGSADTVRDVRGFAVKFYTEEGNWDLVGNNIPVFFIQDAMKFPDVIHAGKPEPQLEFPQAQSAHDNFWDFQYLHTEATHMFCWAMSDRTIPRSYRMMQGFGVNTYTLINDKGERHFVKFHFTPELGVHSLVWDEALKLAGQDPDFHRKDLAEAIENGAYPKWKFGIQVLPESKEHDFDFDILDATKVWPEEQIPIRYIGEMELNKNPDEYFTQTEQVAFCTSHVVPGIGFSDDPLLQGRNFSYFDTQITRLGINWQELPINKPVCPVMNFNRDGQHRQTISKGNTNYWPNRHEAVPPANHSKVSGAYVDFAQKVEGIKQRTKSAKFKEHFSQAQLFFNSLSPIEKLHAANAFAFELDHCEDPVVYERMSQRLADIDLGLAQTVAEMVGGTKPEKAGLANHGKKAKGLSQLEFMPETPTIASRRVAIIIADGFDPVAFGAVQAEVVASMAIPMVIGTRRSEIFPAGVSKTPGNGVKPAHHLEGFRSTMVDAIFVPGGEESIKTLTKNGRAVHWIREAFGHLKAIAATGEGVEFIRTAITLPEVTLSTDSTVTESYGVITMKKFSPDSLKETVKIIKNGKGFLEKFFYTIAQHRVWARELDGLSTQLAY

Retrieve as FASTA  
Remarks Complete sequence from genomic (no known chromo, 2 introns). Strain="M1.001, FGSC 10212". No EST found.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAAACATTCTTCCTGCAACCCTGAAGAAAGCCGGAAACGTCGTCATGGGTCAATCAAACAAGAAGAACGCTCAGCTCGCTGAGAACATGGTCGAGCCTAACCCCAAGGCTCCCATG
ACCACCGACTTTGGCACCAAGATCGAGAACACGGACGACTGGCTACGAGTGACCAACAATGACAAGACCGGTCCCACGCTTCTTGAGGATGCCATTGCCAGGGAAAAG
GTATGCTGTGTC
TGCTTTTTACTGTTTGCATCACTCTTACTAACACTGCCAGATCCACCGTTTCGACCATGAGAGAATCCCTGAGCGAGTCGTTCACGCAAGAGGTGCTGGTGCTTTTGGTACCTTCAGACT
CTTCGAGAGCGCTTCGGATGTGACCAACGCCGGTATCTTGACCGACACCTCTCGCGAGACCCCTCTGTTCCTCCGCTTTTCCACTGTTCTCGGTAGCAGAGGCAGTGCCGACACCGTTCG
CGATGTACGCGGCTTTGCAGTCAAGTTCTACACGGAGGAGGGAAACTGGGACCTTGTTGGAAACAATATTCCCGTTTTCTTCATCCAGGACGCCATGAAGTTCCCCGATGTCATCCACGC
AG
GTAAGTCGTCGTTCTTGCTACCCCTGTTGGGAGTACATCATGCTGACCAAAACCAGGCAAGCCTGAGCCTCAGCTCGAGTTCCCCCAGGCCCAGTCTGCCCATGACAACTTCTGGGAC
TTCCAGTATCTGCATACAGAGGCCACCCACATGTTCTGCTGGGCTATGTCCGACCGCACAATTCCCCGCTCCTACAGAATGATGCAGGGTTTCGGAGTCAACACCTACACCCTCATCAAC
GACAAGGGCGAGCGTCACTTTGTCAAGTTCCATTTCACACCCGAGCTCGGTGTCCACTCCCTCGTTTGGGATGAGGCTCTGAAGCTTGCTGGCCAAGACCCCGACTTCCACCGCAAGGAC
CTCGCCGAGGCTATTGAGAATGGTGCTTACCCCAAATGGAAGTTCGGTATCCAGGTCCTTCCCGAGTCCAAGGAGCATGACTTTGACTTTGACATTCTTGATGCCACCAAGGTCTGGCCT
GAGGAGCAGATCCCCATTCGTTACATCGGAGAGATGGAGCTAAACAAGAACCCCGACGAGTACTTCACCCAGACCGAGCAGGTCGCCTTCTGCACCAGCCACGTCGTTCCTGGCATTGGA
TTTTCCGACGACCCTCTCCTCCAGGGCCGCAACTTTTCTTACTTTGATACCCAAATCACTCGTCTCGGCATCAACTGGCAGGAGCTTCCCATCAACAAGCCCGTGTGCCCCGTAATGAAC
TTCAACAGGGATGGTCAGCACCGCCAAACCATTTCCAAGGGTAACACCAACTATTGGCCTAATCGCCACGAGGCCGTGCCCCCCGCCAACCACTCCAAGGTCTCTGGTGCATACGTCGAC
TTTGCACAGAAGGTGGAGGGCATCAAGCAGCGCACCAAGAGCGCCAAGTTCAAAGAACACTTCAGCCAAGCTCAGCTCTTCTTCAACAGTTTGTCTCCTATTGAGAAGCTTCACGCCGCC
AACGCTTTCGCCTTCGAACTGGACCACTGCGAGGACCCCGTCGTCTACGAGCGCATGTCTCAGCGTCTCGCCGACATCGACCTCGGCTTGGCCCAGACTGTTGCTGAGATGGTTGGTGGA
ACCAAGCCCGAGAAGGCTGGCCTCGCCAACCATGGAAAGAAGGCCAAGGGTCTCAGCCAGCTGGAGTTCATGCCCGAGACACCCACCATCGCCTCGCGTCGCGTGGCCATCATCATCGCC
GATGGCTTCGACCCTGTCGCCTTCGGCGCTGTTCAGGCCGAAGTTGTTGCTTCCATGGCCATTCCTATGGTGATTGGTACTCGGCGCTCCGAGATCTTCCCCGCAGGAGTATCCAAGACA
CCCGGCAATGGTGTCAAGCCCGCTCACCACCTTGAGGGTTTCAGATCCACCATGGTTGATGCTATCTTCGTTCCCGGTGGCGAGGAGTCTATCAAGACCTTGACCAAGAACGGCAGAGCC
GTTCACTGGATCCGAGAGGCTTTCGGTCATCTCAAGGCCATTGCAGCTACCGGTGAGGGTGTTGAATTCATCCGCACTGCCATCACTCTGCCTGAGGTTACTCTGTCCACCGACAGTACC
GTGACAGAGAGTTACGGTGTCATTACGATGAAGAAATTCTCGCCCGACAGCCTCAAGGAGACGGTCAAGATTATTAAGAACGGCAAGGGATTCTTGGAGAAGTTCTTTTACACGATTGCT
CAGCACCGCGTGTGGGCTCGTGAGCTTGACGGTCTTAGCACCCAGCTTGCATACTAA

Retrieve as FASTA