Entry information : DmKat01 (DmKatE)
Entry ID 8425
Creation 2011-06-16 (Marcel Zamocky)
Last sequence changes 2011-06-16 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-06-16 (Christophe Dunand)
Peroxidase information: DmKat01 (DmKatE)
Name (synonym) DmKat01 (DmKatE)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Metazoa Arthropoda Insecta Drosophilidae Drosophila
Organism Drosophila melanogaster (fruit fly)    [TaxId: 7227 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value DmKat01
start..stop
S start..stop
DpKat01 1006 0 1..506 1..506
GmorKat01 809 0 4..456 3..455
DmKat02 793 0 1..506 1..506
AaeKat01 782 0 4..506 3..505
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..57 57 N° 2 3553..4473 921 N° 3 4571..5113 543  
join(1..57,3553..4473,4571..5113)


exon

Literature and cross-references DmKat01 (DmKatE)
Literature Orr W.C., Orr E.C., Legan S.K., Sohal R.S. (1996) Molecular analysis of the Drosophila catalase gene. Arch. Biochem. Biophys. 330:251-258.
Protein ref. UniProtKB:   P17336
DNA ref. GenBank:   AE014296.4 (18815886..18820998)
mRNA ref. GenBank:   X52286
EST ref. GenBank:   AI517000.1
Protein sequence: DmKat01 (DmKatE)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   506
PWM (Da):   %s   56966.34  
PI (pH):   %s   8.15
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAGRDAASNQLIDYKNSQTVSPGAITTGNGAPIGIKDASQTVGPRGPILLQDVNFLDEMSHFDRERIPERVVHAKGAGAFGYFEVTHDITQYCAAKIFDKVKKRTPLAVRFSTVGGESGSADTARDPRGFAVKFYTEDGVWDLVGNNTPVFFIRDPILFPSFIHTQKRNPQTHLKDPDMFWDFLTLRPESAHQVCILFSDRGTPDGYCHMNGYGSHTFKLINAKGEPIYAKFHFKTDQGIKNLDVKTADQLASTDPDYSIRDLYNRIKTCKFPSWTMYIQVMTYEQAKKFKYNPFDVTKVWSQKEYPLIPVGKMVLDRNPKNYFAEVEQIAFSPAHLVPGVEPSPDKMLHGRLFSYSDTHRHRLGPNYLQIPVNCPYKVKIENFQRDGAMNVTDNQDGAPNYFPNSFNGPQECPRARALSSCCPVTGDVYRYSSGDTEDNFGQVTDFWVHVLDKCAKKRLVQNIAGHLSNASQFLQERAVKNFTQVHADFGRMLTEELNLAKSSKF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromosome 3L, 2 introns) and 70 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGGACGCGATGCGGCTTCCAATCAGTTGATTGACTACAAAAACTCCCAAACGGTGAGTGTGTTGGTGTGCGAGCGCGAGAGAGCGCAACTGCATGTGTGTGCGTGTGTGTGCCGG
CAGGAAAATAAGAAAACAAGAAAGGCAAAAAAGACAAAAAGAGAAGGGAGAAGCATTGTACGAAATGAAATAAACAAAAAACAAGACAATTTCAGTAACGATTGCTATGAGCCTGTACTT
TCCATTAATTCCATTAATTATTAAAATGCGAAAAACAACAAAGGCTTGTCCAACAAATGCCAGTAATGATGAAGTCGTTTCCCCAGAGTTCGAAGTTCAAAAGCCGCCTCTCTGGGTCTT
CTATTTATTTGTAGAAATCTTATCAGAAGTGAACTGATAAACCTTATCAGTGTGGCAATTCTTATTGGATTTGTGTTTTCTGTACCTAATCCAAAGTTAATTTTATTTTCCCTTTTATTT
TTATTTTCCTTCTTAAGGAAATCCAAAGTTTAGTCTAGCTAACCTATTTTCTAACCTTGGGCGACCTCTTACCTTAGTCTATTTTCATTTTTCAGCGCTGTTTTCACTTAGCACTTCCAA
TTTCATTTGGCACTTGCATTGTGCATTGGATTTGAGTATTCGAATTTGTTCGTTTGCACTTTTGTGTTAATTATTCGCTTTCGCTTTTGGTTTAGATTAAATGCATGATTTCAATTGTGG
AATCGTGCCCTCTTAAAATTTTGAACAAATATTGTTTGTTCACACTCGGAAAATTGTACTTTCCTAAATTCGTGGCATTCCACAATTGCAACATTTTATACACTGCAATCATTTTTGAAA
TCAAATATGCTGTTACATTTTATAAAAAGGAATGAAATATAACAAAATCAATAGTAAGCCTCACCCATAGATACTGTATCTATATATAATTTACTCGGCAATTTCCCTGTGGTTTTCCCA
ATGCCCTCTAAAAATCGATAAATGAAATAATAATTCTGCATAGCTATTTGTCAGCCAGTTGATAGGCATCCAAAACAGCTAAGTAATTGGCCCAAATAGATTAGATGTATCAGCCGTATA
GATATTGTTGAGTGCCCACATTTGGTTAGTAACTAAAGTAAATTTCCATTGGATTTCGATACTTTGTAAGTATGAATTGTCAGTTCTCAAAGAATACAATCATTTTTTGTTTTTTAATTT
AGTATACCTTTTTTTTACCCTATTCAATTAAGGCTAAATCTAGAACTTAGTTCTCGCATCAGCGATTTAAGTGCATTTGTGCATTGAGTCACGAAGCCAATTACTCCACTAACTAAAAGC
AATCAGCGGTCATTATTTTATATAAACAAATATAGATATGAACTTTTTGAGAAACGCGATCGCTGGATTGCACCGCTTGTAAGTTGGAAAATTCGTTGGGAGTCAATGGACTCTGCGGCG
ACCGGCTCAATGTTGCACAAACTGGTTGCAATGCGCATCGACTGCGAGTGATTCGAGTGACAACGAACCCGGCTTTAAACCCGTTTTGGGTTGAGTGCGGAAGGCTAGACCGCTTCGGAA
AATGCGTGTGCCAGTGCCATAAGTCAACGCAAATTTTCTTTCTCCAATTTGGTTATGCAACCTGGCTGGAACGCCCGGCTAAAAGCGACTGTATGTGAGAATATGTTTCGAACTGACCCA
GAAAAGAGAGCTAGCTCCACAGTTGGTTGGTTGGTTCGTGTTGTTTTAGTCGATTTTGACCTTCTATGACGAAACTGTGAAAACTGCATTCTGTCAGGCAATTAAATGTTTGCCTTTGTT
TCGGTGAATAATCATGGCAACTGGGTTCTTTGTTCTTTTGGGAATCTCGCAATCGAGTTAATTTGTTATCCAAGAAATTCGAAAATGCAAGGAAAATACTTGGAATATTTTGCAACGCAA
TGCATATTGCGTAAGGTCATTGTGAGTCGGTTAAGAACCCTATAAAAATCCTTATTTAAAATCCTTTAGCTTATTTTCTATGCATTCTCATTCTCGAATGAGTAACCTTCTGCTGATAAA
TTATGTCTAGAAGGCAAATTTATCTCATACTATCAGGTGCACTGATCTTATAAAGCCGCCTCATTAAGTTGCTGTTTGCCATCTTTGTGTCATTGGCATCGCCAACAAGTTGCAATTAAA
AACTTTCCTGTAGACTGTGTTCTTTGCATTTCTATTCGAGATCGGTTGCGGTTCTCTTATCAGTTTGCTCTTCGCTGGAGATATCTACAACCAAATACATACATACATATATAAGAACGA
AGGCTCTGATAGGAACCAGATTGACTTGTTGGACGTGGATCGCAGTTCCAGCGGTTCCACTCGCATTGTCATTCCCGGTTTGCTTCACTTATCGTATCTGCCCCCTGAAGTGGCCCCATA
TTAATGTCTCAAAGTGCAAAACATTCCGGCTGAATCGGCCGAATCTAAAGGGTGACTCCAGTATAAATTCCAGAATGATAATTTCGAAATTATATTCATTTCTTCGTTTTTATGTAGCGC
TTTTTGTTTGTCAATAAGTGGGTATACTACTGGCCTGTCTAAGCTGATTTTATTATTAAATAGATACATATATACTTCTAGGAACTAAGATTTGATAAAGTCAACTACTAATTCCTTAAA
CAATTGTAAAAGTCTTAGTGCCCAACCGGGTAATCCCAACCCAAGTGCTATATGTATCTAAATGACTTTGTTGTGAAATATAAACAGTAGCTTAATTTATATGTTTGACACACCACCACC
ACCACCACCGGTGGCTTCACTTTGATAAACAACCTTCTGTATAAAATTCTATATGCATTGTTCTAGAAATGCTTTCGAATTAGAATTTCGCATGGCGTTGTTCAGGTTTCAAATACATTA
GCTAAACAGTGCGCATTGGCCGGTGACAGTTTTGCAAATTGTTGGCTGAGTTAATTTTATAATGAGTGGCTGGCCTGCATGCGAAATAAACGATAAGGTGATTAAGGAGCGGTCTCGGAT
TACTCTAGGGAAATGAATTGAAAACAAGGAGTATGATTAGATCGACTGATAAATGACAGGACAGCTGGTGGGCTAATTGATATTTCAGATGGACAATACACTTTTATTAGCTTAATGGAA
TGAAATAATTAATTGATCGCCAGCTAATAAACTGTGTAACATCATTTTGATGTTTGAATACTTTCATTTAATTGGTTTTTTCCTTGCACACGGATTTGATATCTTGACATGTTAATGCAA
AAAACCCATACATCATCACTATATTAAGGCCTCAAGCTCTTAAGAACACCTGGGATCTCTTATTTTAAATTTATATGCACTGCAAAATGACCCCCCGTGTAGAGATAACGCTCTGCAATC
TTTATGTTAATGTTTTTTTCTTTTGGTGAAAATCGAATGATTAAATGAAAGTCCGCGGGCCAAAAATGAATTATCGCAATAGGCCCGATAAGATTGTAAGACACTTGAACCAATATATTG
TTGCTGAATGTTGCATAGCATTTTAAAATTAAAATACATTTGATTAAACTTGACTTTCATTTGCTTTTGCAGGTTTCTCCTGGTGCCATTACCACCGGCAATGGAGCACCCATTGGAATC
AAGGATGCCTCCCAGACGGTTGGTCCGCGAGGACCTATCCTGCTGCAGGATGTGAACTTCCTGGATGAGATGTCGCACTTCGACAGGGAGCGGATTCCAGAGCGTGTCGTGCACGCCAAG
GGAGCTGGTGCTTTTGGTTACTTTGAGGTGACCCATGACATCACCCAGTATTGTGCCGCCAAGATTTTCGACAAGGTCAAGAAGCGCACTCCACTGGCCGTGCGATTCTCCACCGTGGGT
GGTGAGAGCGGATCTGCGGACACCGCCCGCGATCCTCGAGGATTTGCCGTCAAGTTCTACACTGAGGATGGCGTCTGGGATTTGGTTGGCAACAACACGCCGGTCTTCTTCATTCGCGAC
CCGATCCTATTCCCCAGCTTCATTCACACCCAGAAGCGCAACCCGCAGACGCATCTGAAGGATCCGGACATGTTCTGGGACTTCCTCACCCTGCGACCGGAGTCCGCTCACCAGGTGTGC
ATCCTGTTCAGCGATCGCGGCACCCCCGACGGTTACTGCCACATGAACGGCTATGGCTCGCACACCTTCAAATTGATCAACGCCAAGGGCGAGCCCATCTATGCCAAGTTCCACTTCAAG
ACGGACCAGGGCATCAAGAATCTGGACGTGAAGACCGCCGATCAGTTGGCTAGCACTGATCCGGATTACAGCATTCGCGATCTGTACAACAGGATCAAGACCTGCAAGTTCCCCAGTTGG
ACGATGTACATTCAGGTCATGACCTACGAGCAGGCCAAGAAGTTCAAGTACAACCCCTTCGATGTCACCAAGGTCTGGTCGCAGAAGGAGTACCCTCTGATTCCTGTGGGCAAAATGGTG
CTGGATCGCAATCCCAAGAACTACTTTGCTGAG
GTTCGTTTTTTTTTTTTGTTTCAAATAGATTCTTCTTCATTTGAGATTAATGCAATCAAAAGAAAGATAACTAATATGGTAATTTTC
TGACCCTCAGGTGGAGCAGATCGCCTTCAGTCCCGCTCACCTGGTGCCCGGCGTTGAGCCCTCTCCGGACAAGATGCTGCATGGTCGTCTGTTCTCCTACTCGGACACCCATCGCCATCG
CCTGGGACCGAACTACTTGCAGATCCCGGTGAACTGCCCGTACAAGGTGAAGATTGAGAACTTCCAGCGGGATGGAGCCATGAATGTGACGGACAACCAGGATGGTGCCCCCAACTACTT
CCCCAACTCGTTCAACGGTCCCCAGGAATGCCCCAGGGCCAGGGCCTTGTCCTCCTGCTGTCCGGTGACTGGAGATGTCTACCGCTACAGCAGCGGCGACACCGAGGACAACTTCGGCCA
GGTCACCGACTTCTGGGTGCATGTGCTCGACAAGTGCGCCAAGAAGCGTCTGGTGCAGAACATTGCCGGCCATTTGAGCAACGCCAGCCAGTTCTTGCAGGAGCGGGCCGTCAAGAACTT
CACCCAGGTGCACGCCGATTTCGGTCGCATGCTGACCGAGGAACTCAACCTGGCCAAGTCCTCGAAGTTCTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGCGGCTAGA AATCAACAAC TTTCCAGTTC GAGTGTTTCT AAATTCTGGT TATCCCGTTG AGCAAATATC CTAAATTTTA AGCAAAATGG CTGGACGCGA TGCTGCTTCC AATCAGTTGA  TTGACTACAA AAACTCCCAA ACGGTTTCTC CTGGTGCCAT TACCACCGGC AATGGAGCAC CCATTGGTAT CAAGGATGCC TCCCAGACGG TTGGTCCGCG AGGACCTATC CTGCTGCAGG  ATGTGAACTT CCTGGATGAG ATGTCGCACT TCGACAGGGA GCGGATTCCA GAGCGTGTCG TGCACGCCAA GGGAGCTGGT GCTTTTGGTT ACTTTGAGGT GACCCACGAC ATCACCCAGT  ATTGTGCCGC CAAGATTTTC GACAAGGTCA AGAAACGCAC TCCACTGGCC GTGCGATTCT CCACCGTGGG TGGTGAGAGC GGATCTGCGG ACACCGCCCG CGATCCTCGA GGATTTGCCG  TCAAGTTCTA CACTGAGGAT GGCGTTTGGG ATTTGGTTGG CAACAACACG CCGGTCTTCT TCATTCGCGA CCCGATCCTA TTCCCCAGCT TCATTCACAC CCAGAAGCGC AACCCGCAGA  CGCATCTGAA GGATCCGGAC ATGTTCTGGG ACTTCCTCAC CCTGCGACCG GAGTCCGCTC ACCAGGTGTG CATCCTGTTC AGCGATCGCG GCACCCCCGA CGGTTACTGC CACATGAACG  GCTATGGCTC GCACACCTTC AAATTGATCA ACGCCAAGGG CGAGCCCATC TATGCCAAGT TCCACTTCAA GACGGACCAG GGCATCAAGA ATCTGGACGT GAAGACCGCC GATCAGTTGG  CTAGCACTGA TCCGGATTAC AGCATTCGCG ATCTGTACAA CAGGATCAAG ACCTGCAAGT TCCCCAGTTG GACGATGTAC ATTCAGGTCA TGACCTACGA GCAGGCCAAG AAGTTCAAGT  ACAACCCCTT CGATGTCACC AAGGTCTGGT CGCAGAAGGA GTACCCTCTG ATTCCTGTGG GCAAAATGGT GCTGGATCGC AATCCCAAGA ACTACTTTGC TGAGGTGGAG CAGATCGCCT  TCAGTCCCGC TCACCTGGTG CCCGGCGTTG AGCCCTCTCC GGACAAGATG CTGCATGGTC GTCTGTTCTC CTACTCGGAC ACCCATCGCC ATCGCCTGGG ACCGAACTAC TTGCAGATCC  CGGTGAACTG CCCGTACAAG GTGAAGATTG AGAACTTCCA GCGGGATGGA GCCATGAATG TGACGGACAA CCAGGATGGT GCCCCCAACT ACTTCCCCAA CTCGTTCAAC GGTCCCCAGG  AATGCCCCAG GGCCAGGGCC TTGTCCTCCT GCTGTCCGGT GACTGGAGAT GTCTACCGCT ACAGCAGCGG CGACACCGAG GACAACTTCG GCCAGGTCAC CGACTTCTGG GTGCATGTGC  TCGACAAGTG CGCCAAGAAG CGCCTGGTGC AGAACATCGC CGGCCATTTG AGCAACGCCA GCCAGTTCCT GCAGGAGCGG GCCGTCAAGA ACTTCACCCA GGTGCACGCC GATTTCGGTC  GCATGCTGAC CGAGGAACTC AACCTGGCCA AGTCCTCGAA GTTCTAAGCT GAGCGAGCGG ATTCGACGGA TCAGACTTGG TTTTTGGCCT TAATTACGAT TAATCCAATG GAACTAATTA  TTCCAACACC AACACCACCA CCACCACCAC CAACACCACC CATTCCGAAA TTGACTAAGA AAGGCGAACG CTTTTCGGAT CTTTGGTTGC GGGCTTAAAT TGATTTAACC ACGAAATGTG 
CCTTGTCTTG TTTTGATATT CAAAATTGTT TAAGTCATAA ACAAATTACA CTTACAATGT ATATGTATAT GCAATGAATA TATAATAAAT TCTTTATTTT TTGATAT 

Retrieve as FASTA