Entry information : DmKat02 (DmKatE2)
Entry ID 8426
Creation 2011-06-16 (Marcel Zamocky)
Last sequence changes 2011-06-16 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-06-17 (Christophe Dunand)
Peroxidase information: DmKat02 (DmKatE2)
Name (synonym) DmKat02 (DmKatE2)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Metazoa Arthropoda Insecta Drosophilidae Drosophila
Organism Drosophila melanogaster (fruit fly)    [TaxId: 7227 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value DmKat02
start..stop
S start..stop
DpKat01 800 0 1..506 1..506
DmKat01 793 0 1..506 1..506
GmorKat01 709 0 3..456 2..455
AgaKat01 696 0 3..506 2..504
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 8705695..8706534 840 N° 2 8706598..8707278 681  
join(8705695..8706534,8706598..8707278)


exon

Literature and cross-references DmKat02 (DmKatE2)
Literature Adams M.D., Celniker S.E., Holt R.A., Evans C.A., Gocayne J.D., Amanatides P.G., Scherer S.E., Li P.W., Hoskins R.A., Galle R.F., George R.A., Lewis S.E., Richards S., Ashburner M., Henderson S.N., Sutton G.G., Wortman J.R., Yandell M.D., Venter J.C. (2000) The genome sequence of Drosophila melanogaster. Science 287:2185-2195.
Protein ref. UniProtKB:   Q9VLI6
DNA ref. GenBank:   AE014134.5 (8705695..8707278)
mRNA ref. GenBank:   AY058324
EST ref. GenBank:   AI109972.2
Cluster/Prediction ref. UniGene:   Dm.4312
Protein sequence: DmKat02 (DmKatE2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   506
PWM (Da):   %s   57789.16  
PI (pH):   %s   7.18
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MCSRDTASNQLIDYKNNDSEVQREITTSSGTPVGVKDAIQTVGPRGPALLQDFQFLDEVMHFDSERIPERVAYAKGAGAFGYFECTHDISKFCAASIFDKVRKRTAVAMRFSVACGEQGSADTVREQRGFAVKFYTDDGIWDIVGCNMPVHYVRDPMLFPSLVHAQKRNPQTHLKDPDMFWDFMTLRPETLHALLMYFSDRGTPDGYRHLHGYGVHTYRMINASGETQYVRFHFKTDQGIKNLDARRCEELMSHDPDYAIRDLYNSIKKGNYPSWSMYIQVMLNEEAKKCRFNPFDVTKVWPQKDFPLLPVGKIVLDRNPTNYFTEVEQLAFSPAHMVPGIEPSPDKMLQGRLFAYGDSQRHRLGVNYMQIPVNCPYRVNVRNFQRDGAMTVTDNQNGAPNYFPNSFCGPRESPRALGLQTCCPLSGDVYRFMSGDTEDNFSQVTDFWTYTLDNCGRKRLVRNLSEHLTEASQFLQERAVKLFTMVHSDFGRLMTEALNTARISKF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromosome 2L, 1 intron) and 51 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGTTCACGCGATACGGCGTCAAATCAATTGATTGACTATAAGAACAATGACTCCGAGGTGCAAAGGGAGATCACGACATCCAGTGGAACTCCAGTTGGCGTCAAGGATGCCATACAG
ACGGTGGGACCAAGGGGTCCTGCCCTGCTGCAGGATTTCCAGTTCCTCGACGAGGTGATGCACTTCGACTCGGAGCGGATTCCCGAACGGGTGGCCTACGCCAAGGGAGCCGGCGCCTTT
GGTTACTTCGAGTGCACCCATGACATTTCAAAATTCTGTGCAGCCTCCATATTCGATAAGGTTAGAAAACGAACTGCCGTCGCGATGAGATTCTCGGTGGCCTGCGGTGAACAGGGATCT
GCGGATACGGTACGTGAACAGCGCGGATTTGCCGTCAAATTCTACACCGACGACGGCATCTGGGACATTGTGGGTTGCAACATGCCCGTGCATTATGTCCGGGATCCCATGTTGTTCCCC
AGCTTGGTTCATGCCCAAAAGCGCAATCCCCAGACCCACCTGAAGGATCCGGACATGTTCTGGGACTTCATGACCCTGCGTCCGGAAACCCTGCATGCCCTGCTCATGTACTTTAGCGAT
CGGGGAACCCCAGATGGCTATCGCCACCTGCACGGATACGGTGTGCACACCTACCGCATGATCAATGCCAGTGGGGAGACGCAATACGTTAGGTTCCACTTCAAGACGGACCAGGGCATC
AAGAACCTGGACGCCCGACGATGCGAGGAGCTGATGTCCCACGATCCGGACTATGCCATCAGGGATCTGTACAACTCGATCAAGAAGGGCAACTATCCCAGTTGGTCAATGTACATTCAG
GTAGGAATTATATAGGTCTATATAATCGAGTACCTAGATCGAGAGCTCATTTATAACCACTAGGTGATGCTCAACGAGGAGGCGAAAAAGTGTCGTTTCAATCCGTTCGATGTGACCAAG
GTATGGCCCCAGAAGGACTTCCCCCTGCTTCCAGTTGGCAAGATTGTTCTAGATCGCAATCCCACCAACTATTTCACAGAGGTGGAGCAGCTGGCCTTCAGTCCGGCCCACATGGTGCCG
GGCATCGAGCCATCGCCGGATAAGATGCTCCAGGGTCGCCTCTTCGCCTACGGCGATTCGCAGCGCCATCGTTTGGGCGTGAACTACATGCAGATACCGGTGAATTGTCCGTACCGCGTG
AATGTTCGCAACTTCCAGAGGGATGGTGCTATGACAGTGACTGACAATCAGAACGGGGCTCCCAACTACTTCCCCAATTCCTTTTGCGGACCAAGGGAAAGTCCGCGGGCCTTGGGCCTG
CAGACGTGCTGTCCGTTGAGCGGAGATGTCTATCGATTTATGAGCGGTGACACCGAGGACAATTTCAGTCAGGTCACCGACTTCTGGACCTACACCCTGGATAACTGCGGCCGCAAGCGG
CTAGTTCGCAACTTGTCCGAGCATCTGACCGAAGCTAGCCAGTTCCTTCAGGAGCGGGCAGTGAAACTGTTCACCATGGTGCACTCCGATTTCGGAAGACTGATGACGGAGGCCCTTAAC
ACGGCCAGGATTTCCAAGTTCTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACAAGCAAAA TCACTCACAA CGCTTTTGTT AGCAGTTGAA ATCAACTGTG TGAAATATTT TTTTTGAAAA TAAATTTTTT TTTAGAAATT TTAAGACCAA AGACAAAATT GAAAAATGTG  TTCACGCGAT ACGGCGTCAA ATCAATTGAT TGACTATAAG AACAATGACT CCGAGGTGCA AAGGGAGATC ACGACATCCA GTGGAACTCC AGTTGGCGTC AAGGATGCCA TACAGACGGT  GGGACCAAGG GGTCCTGCCC TGCTGCAGGA TTTCCAGTTC CTCGACGAGG TGATGCACTT CGACTCGGAG CGGATTCCCG AACGGGTGGC CTACGCCAAG GGAGCCGGCG CCTTTGGTTA  CTTCGAGTGC ACCCATGACA TTTCAAAATT CTGTGCAGCC TCCATATTCG ATAAGGTTAG AAAACGAACT GCCGTCGCGA TGAGATTCTC GGTGGCCTGC GGTGAACAGG GATCTGCGGA  TACGGTACGT GAACAGCGCG GATTTGCCGT CAAATTCTAC ACCGACGACG GCATCTGGGA CATTGTGGGT TGCAACATGC CCGTGCATTA TGTCCGGGAT CCCATGTTGT TCCCCAGCTT  GGTTCATGCC CAAAAGCGCA ATCCCCAGAC CCACCTGAAG GATCCGGACA TGTTCTGGGA CTTCATGACC CTGCGTCCGG AAACCCTGCA TGCCCTGCTC ATGTACTTTA GCGATCGGGG  AACCCCAGAT GGCTATCGCC ACCTGCACGG ATACGGTGTG CACACCTACC GCATGATCAA TGCCAGTGGG GAGACGCAAT ACGTTAGGTT CCACTTCAAG ACGGACCAGG GCATCAAGAA  CCTGGACGCC CGACGATGCG AGGAGCTGAT GTCCCACGAT CCGGACTATG CCATCAGGGA TCTGTACAAC TCGATCAAGA AGGGCAACTA TCCCAGTTGG TCAATGTACA TTCAGGTGAT  GCTCAACGAG GAGGCGAAAA AGTGTCGTTT CAATCCGTTC GATGTGACCA AGGTATGGCC CCAGAAGGAC TTCCCCCTGC TTCCAGTTGG CAAGATTGTT CTAGATCGCA ATCCCACCAA  CTATTTCACA GAGGTGGAGC AGCTGGCCTT CAGTCCGGCC CACATGGTGC CGGGCATCGA GCCATCGCCG GATAAGATGC TCCAGGGTCG CCTCTTCGCC TACGGCGATT CGCAGCGCCA  TCGTTTGGGC GTGAACTACA TGCAGATACC GGTGAATTGT CCGTACCGCG TGAATGTTCG CAACTTCCAG AGGGATGGTG CTATGACAGT GACTGACAAT CAGAACGGGG CTCCCAACTA  CTTCCCCAAT TCCTTTTGCG GACCAAGGGA AAGTCCGCGG GCCTTGGGCC TGCAGACGTG CTGTCCGTTG AGCGGAGATG TCTATCGATT TATGAGCGGT GACACCGAGG ACAATTTCAG  TCAGGTCACC GACTTCTGGA CCTACACCCT GGATAACTGC GGCCGCAAGC GGCTAGTTCG CAACTTGTCC GAGCATCTGA CCGAAGCTAG CCAGTTCCTT CAGGAGCGGG CAGTGAAACT  GTTCACCATG GTGCACTCCG ATTTCGGAAG ACTGATGACG GAGGCCCTTA ACACGGCCAG GATTTCCAAG TTCTAGGATG TATTGAGTCA CTTTTTATAA GACTGTGGGC TGTTGAAATA  TTTGGCGTAT TCTTAAAAAT TATTATTATT CTTACCAATT ATTAATTGGT GTTTAAATCT GGTCTAACGT TCAAAATGTG CCCCAACTGA AGAAGAGTAA ATGAGAAATT TGAAATGTAA 
AAAAAAAAAA AAAAAA 

Retrieve as FASTA