Entry information : CelKat01 (CelCtl-1)
Entry ID 8429
Creation 2011-06-16 (Marcel Zamocky)
Last sequence changes 2011-06-16 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-08-11 (Christophe Dunand)
Peroxidase information: CelKat01 (CelCtl-1)
Name (synonym) CelKat01 (CelCtl-1)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Metazoa Chromadorea Rhabditidae Caenorhabditis
Organism Caenorhabditis elegans    [TaxId: 6239 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CelKat01
start..stop
S start..stop
CbrKat01 879 0 2..496 52..546
HcoKat01 756 0 4..492 5..492
KmaKat01 665 0 4..492 6..497
OgaKat 663 0 4..492 6..497
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2580..2633 54 N° 2 1863..2507 645 N° 3 1536..1808 273 N° 4 1..522 522
complement(join(1..522,1536..1808,1863..2507,2580..2633))


exon

Literature and cross-references CelKat01 (CelCtl-1)
Literature Taub J., Lau J.F., Ma C., Hahn J.H., Hoque R., Rothblatt J., Chalfie M. (1999) A cytosolic catalase is needed to extend adult lifespan in C. elegans daf-C and clk-1 mutants. Nature 399:162-166.
Protein ref. UniProtKB:   O61235
DNA ref. GenBank:   AL034488.2 (54715..52083)
mRNA ref. GenBank:   U55384
EST ref. GenBank:   BJ805102.1 [3' end]
Protein sequence: CelKat01 (CelCtl-1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   497
PWM (Da):   %s   57130.86  
PI (pH):   %s   6.8
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPNDPSDNQLKTYKETYPKPQVITTSNGAPIYSKTAVLTAGRRGPMLMQDVVYMDEMAHFDRERIPERVVHAKGAGAHGYFEVTHDITKYCKADMFNKVGKQTPLLVRFSTVAGESGSADTVRDPRGFSLKFYTEEGNWDLVGNNTPIFFIRDAIHFPNFIHALKRNPQTHMRDPNALFDFWMNRPESIHQVMFLYSDRGIPDGFRFMNGYGAHTFKMVNKEGNPIYCKFHFKPAQGSKNLDPTDAGKLASSDPDYAIRDLFNAIESRNFPEWKMFIQVMTFEQAEKWEFNPFDVTKVWPHGDYPLIEVGKMVLNRNVKNYFAEVEQAAFCPAHIVPGIEFSPDKMLQGRIFSYTDTHYHRLGPNYIQLPVNCPYRSRAHTTQRDGAMAYESQGDAPNYFPNSFRGYRTRDDVKESTFQTTGDVDRYETGDDHNYEQPRQFWEKVLKEEERDRLVGNLASDLGGCLEEIQNGMVKEFTKVHPDFGNALRHQLCQKKH

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromosome II, 3 introns) and at least 100 ESTS. Strain="Bristol N2".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTAATGCTTCTTCTGGCAGAGCTGATGGCGAAGAGCATTTCCGAAATCCGGATGAACTTTCGTGAACTCTTTGACCATTCCATTTTGAATTTCCTCCAAACAGCCACCCAAATCACTAGC
CAAATTCCCAACGAGCCGATCTCTCTCCTCCTCCTTGAGCACTTTCTCCCAGAACTGACGTGGCTGCTCGTAGTTGTGATCGTCTCCAGTCTCATAACGATCAACATCTCCAGTCGTCTG
AAATGTCGACTCCTTCACATCATCACGAGTACGGTATCCGCGGAAACTGTTCGGGAAGTAATTCGGCGCATCTCCCTGGCTTTCATAAGCCATTGCACCATCGCGTTGAGTGGTATGAGC
ACGGGAGCGGTACGGGCAGTTGACTGGAAGCTGAATGTAGTTTGGTCCAAGGCGATGGTAATGCGTGTCCGTGTAGGAGAAGATACGCCCTTGGAGCATCTTGTCTGGCGAGAACTCGAT
TCCTGGGACGATGTGGGCCGGGCAGAAGGCGGCTTGTTCGACCTGAAAACCAAAATAAAAAATATTTTTACTCCACCTTTAAAGCTAGACGTAAAATGCAATTTTTATTGTTCCTATTAG
GTCTCCAAATAAGTTCCGGGTCAAAAATCAGAACTTTTTTTGCCTTTTATAGATTTTTTTGAAACTTTGGGAATTTATGTTATCAACTATGACCTTTCATTTTGAAATGGTCACAAAATT
TTTTGACCACCCGGAGCGCCCTAACTCGGAGCCATTTTTTTCAGGCATTTT
TCAGATCTCGCTTCTTTTCAGGTTTCAATTGAGGTTTGTGTGCGGATTTTGCTTAGTTTAGTACACAAT
GTAAGAAAACAAAAAAAGTTTGGAAAAAATCCGTCCAAAAAAATTTTTTTTGTCGGTCGTCAAAAAATCTTCAAAAAAATTTTTTTTCGAAAATTCTCGATTTTTTATACAAGAATGATG
TAACCATGTGCAAACTATTTTTACACATACAAAACATTTGAGTATGAAATTTGGATCTCGAGAAATACTCCAAGAACTCGAAAATTTTTCGAAAAAGCTGTGTTTTCTGTTATTGTTTTA
GTGTGACGCAATAAATTG
AAATGTTTTGTATGTGTAAAAATAGTTTGCACATGGTTACATCATTTTTGTATAAAAAATCGAGAATTTTCGAAAAAAAAATTTTTTGAAGATTTTTTGACG
ACCGACAAAAAAAATTTTTTTGGACGGATTTTTTCCAAACTTTTTGTTTTCTTACATTGTGTACTAAACTAAGCAAAATCCGCACACAAACCTCAATTGAAACCTGAAAAGAAGCGAGAT
CTGAAAAATGCCTGAAAAAATTGGCTCCGAGTTAGGGCACTTCGGACGGCCAAAAAATTTTGTGACTATTGTCAAATGAAAGATCATAGTTGATAACGTAAATTCCTACAGTTTCATAAA
AATCGATACACAGCGAACAAAGTTATGATTTTTGACCCGGAACTTATTTGGAGACCTAATATTAAAAAAAACTAATTCATCTTCACACCACTTGCCTCAGCGAAATAATTCTTCACATTC
CTGTTCAGCACCATCTTGCCGACCTCGATCAGTGGGTAATCACCGTGTGGCCAAACTTTAGTGACATCAAATGGATTGAACTCCCATTTCTCAGCTTGTTCGAATGTCATCACTTGAATG
AACATCTTCCATTCCGGGAAATTTCTTGACTCAATGGCATTGAACAGGTCGCGGATCGCATAGTCTGGATCCGAAGAGGCGAGCTTTCCAGCGTCAGTTGGATCGAGATTCTTGGAACCT
TGAGCAGGCTGAAAAATAGAAAATGAAAATTTAATTCTAGTCCCCGTCTCTCTTAGGCTTACCTTGAAATGGAATTTACAATAAATCGGATTTCCCTCCTTGTTGACCATCTTGAAAGTA
TGCGCTCCGTATCCATTCATAAAACGGAATCCATCAGGAATTCCACGATCCGAGTAGAGGAACATCACCTGATGAATGGATTCAGGGCGATTCATCCAGAAATCGAAGAGCGCATTCGGA
TCCCTCATGTGAGTCTGTGGATTGCGCTTCAGGGCATGAATGAAATTCGGAAAGTGGATTGCGTCACGAATGAAGAAGATCGGAGTGTTATTTCCAACCAGATCCCAGTTACCCTCCTCG
GTATAGAATTTGAGAGAGAATCCACGTGGATCGCGGACAGTATCAGCGGATCCCGATTCTCCAGCGACCGTTGAAAAACGAACGAGAAGTGGTGTCTGTTTTCCGACCTTGTTGAACATA
TCGGCCTTACAGTACTTGGTGATGTCATGGGTGACCTCGAAGTATCCATGGGCTCCGGCTCCCTTGGCATGAACGACACGCTCGGGGATACGTTCACGATCGAAATGAGCCATCTCATCC
ATATAAACTACATCTTGCATGAGCATTGGGCCACGCCGCCCGGCGGTGAGCACGGCGGTCTTCGAGTAGATCGGAGCTCCATTTGAAGTTGTGATCACTTGGGGTTTCTGAAACAAGTTA
CTGTAAATAGTAGTTGTTGTTGTAGAAAATGCGTCTGTGCCTTTAAACTCTAAACTCACTGGATACGTCTCCTTGTAGGTTTTCAGTTGATTATCCGATGGATCGTTTGGCAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTAATGCTTCTTCTGGCAGAGCTGATGGCGAAGAGCATTTCCGAAATCCGGATGCCCAACGAGCCGATCTCTCTCCTCCTCCTTGAGCACTTTCTCCCAGAACTGACGTGGCTGCTCGTA
GTTGTGATCGTCTCCAGTCTCATAACGATCAACATCTCCAGTCGTCTGAAATGTCGACTCCTTCACATCATCACGAGTACGGTATCCGCGGAAACTGTTCGGGAAGTAATTCGGCGCATC
TCCCTGGCTTTCATAAGCCATTGCACCATCGCGTTGAGTGGTATGAGCACGGGAGCGGTACGGGCAGTTGACTGGAAGCTGAATGTAGTTTGGTCCAAGGCGATGGTAATGCGTGTCCGT
GTAGGAGAAGATACGCCCTTGGAGCATCTTGTCTGGCGAGAACTCGATTCCTGGGACGATGTGGGCCGGGCAGAAGGCGGCTTGTTCGACCTGAAAACCAAAATAAAAAATATTTTTACT
CCACCTTTAAAGCTAGACGTAAAATGCAATTTTTATTGTTCCTATTAGGTCTCCAAATAAGTTCCGGGTCAAAAATCAGAACTTTTTTTGCCTTTTATAGATTTTTTTGAAACTTTGGGA
ATTTATGTTATCAACTATGACCTTTCATTTTGAAATGGTCACAAAATTTTTTGACCACCCGGAGCGCCCTAACTCGGAGCCATTTTTTTCAGGCATTTT
AGTTTAGTACACAATGTAAGA
AAACAAAAAAAGTTTGGAAAAAATCCGTCCAAAAAAATTTTTTTTGTCGGTCGTCAAAAAATCTTCAAAAAAATTTTTTTTCGAAAATTCTCGATTTTTTATACAAGAATGATGTAACCA
TGTGCAAACTATTTTTACACATACAAAACATTTGAGTATGAAATTTGGATCTCGAGAAATACTCCAAGAACTCGAAAATTTTTCGAAAAAGCTGTGTTTTCTGTTATTGTTTTAGTGTGA
CGCAATAAATTG
GAAGAAGATCGGAGTGTTATTTCCAACCAGATCCCAGTTACCCTCCTCGGTATAGAATTTGAGAGAGAATCCACGTGGATCGCGGACAGTATCAGCGGATCCCGATTC
TCCAGCGACCGTTGAAAAACGAACGAGAAGTGGTGTCTGTTTTCCGACCTTGTTGAACATATCGGCCTTACAGTACTTGGTGATGTCATGGGTGACCTCGAAGTATCCATGGGCTCCGGC
TCCCTTGGCATGAACGACACGCTCGGGGATACGTTCACGATCGAAATGAGCCATCTCATCCATATAAACTACATCTTGCATGAGCATTGGGCCACGCCGCCCGGCGGTGAGCACGGCGGT
CTTCGAGTAGATCGGAGCTCCATTTGAAGTTGTGATCACTTGGGGTTTCTGAAACAAGTTACTGTAAATAGTAGTTGTTGTTGTAGAAAATGCGTCTGTGCCTTTAAACTCTAAACTCAC
TGGATACGTCTCCTTGTAGGTTTTCAGTTGATTATCCGATGGATCGTTTGGCAT

Retrieve as FASTA