Entry information : CbrKat01
Entry ID 8430
Creation 2011-06-16 (Marcel Zamocky)
Last sequence changes 2011-06-16 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-08-11 (Christophe Dunand)
Peroxidase information: CbrKat01
Name CbrKat01
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Metazoa Chromadorea Rhabditidae Caenorhabditis
Organism Caenorhabditis briggsae    [TaxId: 6238 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CbrKat01
start..stop
S start..stop
CelKat01 879 0 52..546 2..496
HcoKat01 753 0 56..542 7..492
DmaKat01 675 0 56..542 7..496
AviKat01 667 0 56..547 7..498
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 787637..787704 68 N° 2 787806..787876 71 N° 3 787978..788042 65 N° 4 788112..788756 645
N° 5 788799..789071 273 N° 6 789123..789644 522  
join(787637..787704,787806..787876,787978..788042,788112..788756,788799..789071, 789123..789644)


exon

Literature and cross-references CbrKat01
Literature Stein L.D., Bao Z., Blasiar D., Blumenthal T., Brent M.R., Chen N., Chinwalla A., Clarke L., Clee C., Coghlan A., Coulson A., D'Eustachio P., Fitch D.H.A., Fulton L.A., Fulton R.E., Griffiths-Jones S., Harris T.W., Hillier L.W., Waterston R.H. (2003) The genome sequence of Caenorhabditis briggsae: a platform for comparative genomics. PLoS Biol. 1:166-192.
Protein ref. GenBank:   CAP37752 UniProtKB:   A8XYN6
DNA ref. GenBank:   CAAC02000575.1 (787637..789644)
Protein sequence: CbrKat01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   547
PWM (Da):   %s   62614.69  
PI (pH):   %s   6.94
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPNLTIASVSRSNIHRLARCFFSVDSTKYAQSKDPKMPMLPHAINSGDSQPGAIADDQLKQYRDTHEPHVLTMSNGAPIYTKTASLTAGSRGPMLLQDVVFLDEMAHFDRERIPERVVHAKGGGAHGYFEVTHDITKYCKADMFSEIGKKTPMLARFSTVGGESGSADTARDPRGFALKFYTEEGNWDLVGNNTPIFFIRDAIHFPNFIHTQKRNPRTHLKDRNAMYDFWINRPESIHQVMFLFSDRGTPDGFRHMNGYGSHAFKMVNKEGQPIYCKFHFKPKQGVKNLSAADANKLAGDNPDYAIEDLFNAIEKKNFPEWTLFIQVMTFEQAEKWEMNPFDVTKVWPHGDFPLIEVGKMILNRNPKNYFAEIEQSAFCPAHVVPGIEFSPDKMLQGRLFSYTDTHYHRLGPNYIQLPVNCPYRSRAHNTQRDGLMTIDSQEDAPNYFPNSFNGYRTREDVKESTFGLTGDVDRYETTDDHNFEQPRQFWEKVLKEDERDRLVENFADSLSGCYEQIQEGMLKIFSKVHPDFGNAVRHALCQRKK*

Retrieve as FASTA  
Remarks Complete sequence from genomic, 5 introns. Strain="AF16". No EST found. Clade 3 catalase.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCAAATCTCACGATCGCTTCCGTTTCTAGAAGCAATATTCATCGCCTTGCTCGTTGTTTTTTCAGGTTTGTTTACCTTATTTTCTTCGCCAATTTTTCGAAATTTCTAATCCGTTTC
CGGCACAATCTCTTTTTTCGCACTTTTCTCTCTAATCCTAATTTTTCAGTGTCGATTCAACGAAATACGCACAATCAAAGGACCCCAAAATGCCGATGCTTCCGCATGCGATCAATTTGT
GTGAGTTTTCTTTTCGCATATTTAATTCAAGTGTGTATCGAGTTACATTCGCTATTGTGCTCAACAATTGTACAACCTAATATTAAAAATGTCTCTTTCAGCCGGCGATTCCCAGCCAGG
AGCCATTGCTGATGATCAGTTGAAGCAGTATCGAGATACACACAAG
GTAAGGAAAATTCTTGATTTTCACATTTTTTCTATGAGAATTTGTATTCTTTCAATTTTTGTTTTTCAGGAGCC
ACATGTCCTCACAATGTCCAATGGAGCACCAATCTACACAAAAACCGCCTCCTTGACAGCTGGAAGTCGTGGACCAATGCTCTTGCAAGATGTCGTTTTCTTGGATGAAATGGCTCATTT
CGATCGCGAACGCATTCCAGAGCGTGTCGTGCATGCAAAAGGAGGCGGTGCTCATGGATACTTTGAAGTCACCCATGATATCACGAAATACTGTAAAGCTGATATGTTCAGTGAAATCGG
AAAGAAGACACCAATGCTGGCTAGATTCTCTACTGTCGGTGGAGAGAGTGGATCCGCTGATACTGCTCGCGATCCACGTGGATTTGCTCTCAAGTTTTACACTGAAGAAGGCAACTGGGA
TTTGGTTGGAAACAACACTCCAATCTTCTTCATCCGTGACGCAATCCATTTCCCGAATTTCATTCACACCCAGAAAAGAAATCCACGCACTCATTTGAAAGATCGCAATGCTATGTACGA
CTTCTGGATTAACCGTCCTGAGTCGATTCATCAAGTAATGTTCCTATTCTCGGATCGCGGAACTCCTGATGGTTTCCGCCATATGAATGGATATGGATCTCATGCATTCAAGATGGTCAA
CAAAGAAGGACAACCGATTTATTGCAAGTTCCATTTCAAG
GTGAGGCTTTAAAATCAAATATTACGAAACTGAATTTTCTAGCCGAAACAAGGAGTCAAGAATCTGAGTGCTGCCGATGC
TAATAAACTTGCTGGGGATAATCCAGACTATGCTATCGAAGATTTGTTCAATGCTATCGAGAAGAAAAACTTCCCTGAATGGACCTTGTTCATCCAGGTGATGACTTTCGAGCAGGCTGA
AAAATGGGAAATGAATCCATTCGATGTGACCAAGGTCTGGCCACATGGAGATTTCCCATTGATTGAAGTTGGAAAAATGATTCTTAACAGAAATCCAAAAAACTATTTCGCTGAG
GTATG
TAGCATAATATTTATCAATTTCTTCAACATCATAAAAATATTTCAGATTGAGCAATCTGCCTTCTGCCCAGCCCACGTTGTACCAGGAATCGAATTCTCGCCGGACAAGATGCTTCAAGG
ACGTCTTTTCTCATACACTGATACTCACTATCATCGTCTCGGACCAAACTACATCCAGCTGCCAGTCAACTGCCCATACCGTTCTCGTGCTCACAACACCCAACGCGACGGATTAATGAC
GATTGACAGCCAGGAGGATGCTCCGAACTACTTCCCAAACAGTTTCAACGGATACCGTACCCGGGAAGATGTGAAAGAGTCGACATTTGGATTGACTGGTGACGTCGATCGCTACGAAAC
AACCGATGATCACAACTTCGAACAACCACGTCAATTCTGGGAGAAGGTGTTGAAAGAAGACGAGAGAGATCGTTTGGTTGAGAATTTCGCAGATTCTTTGTCCGGATGCTACGAGCAAAT
TCAAGAGGGAATGCTCAAAATCTTCAGCAAGGTTCACCCAGATTTCGGAAACGCCGTTCGTCATGCGTTGTGCCAGAGGAAGAAGTAA

Retrieve as FASTA