Entry information : AcoPrx23 (AcoGoldSmith_v1.008240m)
Entry ID 8449
Creation 2011-08-09 (Bruno Savelli)
Last sequence changes 2011-10-03 (Bruno Savelli)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-10-15 (Christophe Dunand)
Peroxidase information: AcoPrx23 (AcoGoldSmith_v1.008240m)
Name (synonym) AcoPrx23 (AcoGoldSmith_v1.008240m)
Class Class III peroxidase    [Orthogroup: Prx098]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx23
start..stop
S start..stop
AfpPrx23 680 0 1..331 1..331
AcoPrx63 647 0 1..328 1..327
AcoPrx97 560 0 1..328 1..327
AcoPrx95 525 0 1..328 1..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1723064..1723294 231 N° 2 1722728..1722922 195 N° 3 1722063..1722632 570  
complement(join(1722063..1722632,1722728..1722922,1723064..1723294))


exon

Literature and cross-references AcoPrx23 (AcoGoldSmith_v1.008240m)
DNA ref. Phytozome 12:   scaffold_2 (1723294..1722063)
Protein sequence: AcoPrx23 (AcoGoldSmith_v1.008240m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332
PWM (Da):   %s   35807.94 Transmb domain:   %s   i12-34o
PI (pH):   %s   7.31
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAIPSSSKQYNIFLILLIFFTTILTTPVLAHLSVGFYASTCPSVFDTVRSATRSAINREARMGASLIRLFFHDCFVNGCDGGILLVDTTEVPGEQSTLHNANSVRGFEVIDNIKTQVDRACGGSVVSCADILAIAARDSVVELGGPSYSIPVGRRDARAPSRAQAESDLPGFNEDLRLLLSKFSAKGFNPQEMVALSGAHTVGQAQCAVYRERIWNDTNIDPTYAESLRGNCPSTADPASDRVLAPLDPQSPNRFGNSYFQAVINRKTVLRSDQVIFDGGSTDNIVRGYSNSPTTFSTDFANAMVKMGNLSPLTGTQGEIRRDCKRPNKIC*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAATTCCTAGTAGCTCAAAGCAGTACAATATATTTTTAATCCTCCTCATTTTCTTCACCACTATCTTAACCACCCCAGTCTTAGCACATCTCTCAGTTGGTTTCTATGCTAGTACA
TGCCCTTCAGTATTCGACACTGTCCGTAGTGCAACACGGTCTGCCATCAATAGAGAAGCTCGTATGGGGGCATCTCTTATTCGCCTCTTCTTCCACGACTGTTTTGTAAAT
GTAAGTTTC
ATCCTGTCCGCAACATTGGATTTTTCAGATGCATACCAACTATGTAACACCCTAGACATCGACTATTAGTTGTTGTTTTTTTTATTGATTTATTTAATTATGCATTAATATTTGATTGAA
TGTTTCATGCAGGGATGTGATGGAGGGATTCTTTTGGTGGACACAACAGAAGTTCCCGGCGAACAGAGTACACTGCATAATGCAAACTCGGTCAGAGGGTTTGAGGTGATCGATAACATT
AAGACACAGGTTGATAGAGCCTGTGGAGGCTCTGTAGTGTCCTGTGCTGATATTTTGGCAATTGCAGCGCGCGATTCTGTTGTGGAA
GTGAGTACTTTCAATCATTACTAACATCCATGC
ACGCACATGAAATAAAAGAAATAAAATGGAATCTAATTGTGTTTTCTTTGGATATGCAACAGCTTGGAGGACCGTCTTATTCAATCCCAGTAGGAAGAAGAGATGCTAGAGCCCCAAGTA
GAGCTCAAGCCGAGAGTGATCTTCCTGGATTTAATGAGGACCTTAGGCTACTTCTCTCTAAATTCAGTGCTAAAGGATTTAATCCTCAAGAAATGGTTGCACTGTCTGGTGCACACACAG
TTGGTCAAGCCCAATGTGCAGTATATAGAGAGCGAATCTGGAACGATACAAATATTGATCCTACATATGCAGAATCATTACGGGGTAATTGCCCGAGTACTGCCGACCCTGCCAGTGACC
GCGTTTTGGCTCCTCTGGACCCCCAAAGTCCAAATCGATTTGGAAATAGTTATTTTCAAGCAGTGATCAATAGAAAGACAGTTCTACGTTCTGATCAAGTAATATTTGATGGTGGATCAA
CAGATAATATTGTAAGAGGTTATAGCAACAGCCCTACCACTTTCTCAACTGATTTCGCCAATGCTATGGTGAAGATGGGGAACTTGAGTCCCTTGACTGGTACCCAAGGTGAAATTCGAA
GAGATTGTAAGAGGCCCAATAAAATATGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAATTCCTAGTAGCTCAAAGCAGTACAATATATTTTTAATCCTCCTCATTTTCTTCACCACTATCTTAACCACCCCAGTCTTAGCACATCTCTCAGTTGGTTTCTATGCTAGTACA
TGCCCTTCAGTATTCGACACTGTCCGTAGTGCAACACGGTCTGCCATCAATAGAGAAGCTCGTATGGGGGCATCTCTTATTCGCCTCTTCTTCCACGACTGTTTTGTAAAT
GGATGTGAT
GGAGGGATTCTTTTGGTGGACACAACAGAAGTTCCCGGCGAACAGAGTACACTGCATAATGCAAACTCGGTCAGAGGGTTTGAGGTGATCGATAACATTAAGACACAGGTTGATAGAGCC
TGTGGAGGCTCTGTAGTGTCCTGTGCTGATATTTTGGCAATTGCAGCGCGCGATTCTGTTGTGGAA
CTTGGAGGACCGTCTTATTCAATCCCAGTAGGAAGAAGAGATGCTAGAGCCCCA
AGTAGAGCTCAAGCCGAGAGTGATCTTCCTGGATTTAATGAGGACCTTAGGCTACTTCTCTCTAAATTCAGTGCTAAAGGATTTAATCCTCAAGAAATGGTTGCACTGTCTGGTGCACAC
ACAGTTGGTCAAGCCCAATGTGCAGTATATAGAGAGCGAATCTGGAACGATACAAATATTGATCCTACATATGCAGAATCATTACGGGGTAATTGCCCGAGTACTGCCGACCCTGCCAGT
GACCGCGTTTTGGCTCCTCTGGACCCCCAAAGTCCAAATCGATTTGGAAATAGTTATTTTCAAGCAGTGATCAATAGAAAGACAGTTCTACGTTCTGATCAAGTAATATTTGATGGTGGA
TCAACAGATAATATTGTAAGAGGTTATAGCAACAGCCCTACCACTTTCTCAACTGATTTCGCCAATGCTATGGTGAAGATGGGGAACTTGAGTCCCTTGACTGGTACCCAAGGTGAAATT
CGAAGAGATTGTAAGAGGCCCAATAAAATATGTTAA

Retrieve as FASTA