Entry information : AcoPrx06 (AcoGoldSmith_v1.006997m)
Entry ID 8450
Creation 2011-08-09 (Bruno Savelli)
Last sequence changes 2011-09-28 (Bruno Savelli)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-14 (Qiang Li)
Peroxidase information: AcoPrx06 (AcoGoldSmith_v1.006997m)
Name (synonym) AcoPrx06 (AcoGoldSmith_v1.006997m)
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx06
start..stop
S start..stop
AfpPrx11 764 0 1..370 1..370
AcoPrx05 497 8e-178 1..369 1..370
AcoPrx09 489 1e-174 1..365 1..364
AfpPrx04 486 2e-173 1..365 1..364
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1675366..1675689 324 N° 2 1675777..1675968 192 N° 3 1676048..1676213 166 N° 4 1676694..1677124 431
join(1675366..1675689,1675777..1675968,1676048..1676213,1676694..1677124)


exon

Literature and cross-references AcoPrx06 (AcoGoldSmith_v1.006997m)
DNA ref. Phytozome 12:   scaffold_20 (1675366..1677124)
Protein sequence: AcoPrx06 (AcoGoldSmith_v1.006997m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   371 (344)
PWM (Da):   %s   40490.11 (37593.5)  
PI (pH):   %s   4.57 (4.50) Peptide Signal:   %s   cut: 27 range:27-370
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MWETAKKLSVLVLTVSLLLSLGNQSGEQIKNGSLDASSSSFSWIRRLLYFNNNEVEIDDSNDLEYDFYQDSCSNAELLVGAMIRSLYRSQPDVAPALLRLMFHDCFIQGCDGSVLLDSPNAGNQSEKDTVPNLTLKGFDIIEKIKSKVEEECPATVSCADILVLAAREGIILAGGPYYPVITGRRDSLVSFPEIAAVEIPSPNDDLSKTITLFASRGFNVRETVSLLGAHNMGKVHCHFFHNRLYNHSGTGLPDPALEPGTLNLMRSTCDNSNDQTEEPSINMGSEGAPEPEFGTHYYKNLVQGKGILHADQQLMAGEETARLVEIYASDGSLFQVNFAQAMMKLSNLRVLTGPLGQIRINCSTVNAEVQ*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGGGAAACTGCAAAGAAACTGAGTGTTTTAGTACTTACAGTCTCTTTACTTCTTTCTCTTGGTAATCAAAGTGGTGAGCAGATTAAGAATGGTAGCTTAGATGCATCGAGTTCATCT
TTTTCATGGATTCGTCGTCTTCTTTACTTTAATAATAATGAAGTAGAGATCGATGATTCTAATGATCTTGAATACGATTTCTACCAAGATTCTTGCTCAAACGCTGAACTTCTTGTTGGA
GCAATGATCCGATCACTTTACAGGTCTCAACCTGATGTTGCTCCAGCTTTATTGCGTTTGATGTTTCATGATTGCTTCATTCAA
GTAGGTTTTTTACTGAAATTAAAATTTTGATTTGTT
AATTTTGATTAGGTTTTTTTTTTTTTGTTAATTTGATTGGATTTCTTGCAGGGATGTGATGGATCTGTTCTATTGGATTCTCCCAATGCTGGTAATCAATCTGAGAAAGATACTGTACCT
AATCTGACATTGAAAGGTTTCGATATAATCGAAAAAATCAAATCCAAAGTCGAAGAAGAGTGTCCTGCAACAGTTTCTTGTGCTGATATTCTTGTTCTTGCAGCTAGAGAAGGAATTATT
TTG
GTAATGGTGTTTTGGTAATGTATTGATTATGTTGGTGTTTCCGTCGATTTGCTCTTCTGATTGTTTGTTGTTATTTCAGGCTGGTGGTCCTTACTATCCTGTGATTACTGGAAGGAG
AGATAGTCTTGTATCGTTTCCTGAAATTGCCGCTGTTGAGATTCCATCTCCTAATGATGATCTTTCCAAGACCATTACATTATTTGCTAGTAGAGGATTTAATGTGAGAGAGACTGTCAG
TCTCTTAG
GTAAGCTTAATCTTCTTTCTTAGAATTTCTCTGTAGTTTGATGGAATTAGTGAACTAGGTGTTTTGTAGAACCTCTGAGTCATACTTAACTATCTGCTTCTGCATTGGATTG
TAAATTGTTTATTTGGCACGTTGCGTGAATACTTAACAATCAGTATTGTTTGGTTGATCTTATTCAACACCTTGCGTGATTAATGACCTCATCATTTTGCTAGAACGTGTTCTGCTGATC
AATGGATGGGATTTTGACAAAAAAATTCTGGTTTTGATAATTAAAACTTGAATTTATGCGAAGTAGTTAATGAGATTGAATGAAGTTGATAGACGCATTTGGAAACATTTTGTCACCTTC
AACAGTTGATAATCCTATTGAGCATATGTTATTTCTGATAAATTTTAAACTCGTGGTAATATGGAACTAGTTTAGTGTTAATCTATTTTTTGTTCTTTTTAATCAACTATATGATATATG
TTCATCAGGTGCTCATAACATGGGAAAAGTTCACTGTCACTTCTTCCACAACCGCCTATACAACCACTCAGGAACTGGCTTACCTGACCCAGCTCTAGAACCTGGAACTCTCAACCTGAT
GAGATCAACATGTGATAACAGCAACGATCAGACAGAGGAGCCTAGCATTAATATGGGGTCTGAGGGAGCACCCGAACCAGAGTTTGGTACACACTACTACAAGAATTTGGTGCAAGGGAA
GGGTATTCTACATGCTGATCAGCAGTTGATGGCCGGTGAAGAAACTGCAAGGTTGGTGGAAATCTACGCATCAGATGGATCACTGTTCCAGGTGAACTTTGCACAAGCAATGATGAAGCT
TTCGAACCTTCGAGTCCTTACAGGACCACTGGGCCAGATCAGGATCAATTGCTCTACAGTCAATGCAGAAGTACAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGGGAAACTGCAAAGAAACTGAGTGTTTTAGTACTTACAGTCTCTTTACTTCTTTCTCTTGGTAATCAAAGTGGTGAGCAGATTAAGAATGGTAGCTTAGATGCATCGAGTTCATCT
TTTTCATGGATTCGTCGTCTTCTTTACTTTAATAATAATGAAGTAGAGATCGATGATTCTAATGATCTTGAATACGATTTCTACCAAGATTCTTGCTCAAACGCTGAACTTCTTGTTGGA
GCAATGATCCGATCACTTTACAGGTCTCAACCTGATGTTGCTCCAGCTTTATTGCGTTTGATGTTTCATGATTGCTTCATTCAA
GGATGTGATGGATCTGTTCTATTGGATTCTCCCAAT
GCTGGTAATCAATCTGAGAAAGATACTGTACCTAATCTGACATTGAAAGGTTTCGATATAATCGAAAAAATCAAATCCAAAGTCGAAGAAGAGTGTCCTGCAACAGTTTCTTGTGCTGAT
ATTCTTGTTCTTGCAGCTAGAGAAGGAATTATTTTG
GCTGGTGGTCCTTACTATCCTGTGATTACTGGAAGGAGAGATAGTCTTGTATCGTTTCCTGAAATTGCCGCTGTTGAGATTCCA
TCTCCTAATGATGATCTTTCCAAGACCATTACATTATTTGCTAGTAGAGGATTTAATGTGAGAGAGACTGTCAGTCTCTTAG
GTGCTCATAACATGGGAAAAGTTCACTGTCACTTCTTC
CACAACCGCCTATACAACCACTCAGGAACTGGCTTACCTGACCCAGCTCTAGAACCTGGAACTCTCAACCTGATGAGATCAACATGTGATAACAGCAACGATCAGACAGAGGAGCCTAGC
ATTAATATGGGGTCTGAGGGAGCACCCGAACCAGAGTTTGGTACACACTACTACAAGAATTTGGTGCAAGGGAAGGGTATTCTACATGCTGATCAGCAGTTGATGGCCGGTGAAGAAACT
GCAAGGTTGGTGGAAATCTACGCATCAGATGGATCACTGTTCCAGGTGAACTTTGCACAAGCAATGATGAAGCTTTCGAACCTTCGAGTCCTTACAGGACCACTGGGCCAGATCAGGATC
AATTGCTCTACAGTCAATGCAGAAGTACAGTGA

Retrieve as FASTA