Entry information : AcoPrx100 (AcoGoldSmith_v1.027646m)
Entry ID 8452
Creation 2011-08-09 (Bruno Savelli)
Last sequence changes 2011-10-03 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-07 (Achraf Jemmat)
Peroxidase information: AcoPrx100 (AcoGoldSmith_v1.027646m)
Name (synonym) AcoPrx100 (AcoGoldSmith_v1.027646m)
Class Class III peroxidase    [Orthogroup: Prx017]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx100
start..stop
S start..stop
AcoPrx60 580 0 9..330 3..323
AcoPrx68 565 0 1..330 1..330
AcoPrx93 523 0 17..330 1..313
AcoPrx56 501 0 1..330 1..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5480906..5481118 213 N° 2 5481226..5482005 780  
join(5480906..5481118,5481226..5482005)


exon

Literature and cross-references AcoPrx100 (AcoGoldSmith_v1.027646m)
DNA ref. Phytozome 12:   scaffold_3 (5480906..5482005)
Protein sequence: AcoPrx100 (AcoGoldSmith_v1.027646m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (307)
PWM (Da):   %s   36009.08 (33319.6) Transmb domain:   %s   i5-27o
PI (pH):   %s   8.15 (7.96) Peptide Signal:   %s   cut: 24 range:24-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKTTFITYLLLIFAISMTTLVSSASLQVGFYRSTCPSAELIVRRAVKSVVSRNPGIAAGLIRMHFHDCFVRGCDASVLLDSSTPENPSEKEHPANNPSLRGFEVIYEAKDLIEAICPQVVSCADIIAFAARDSACQVGGINYAVPAGRRDGRVSLKGEVSQNLPPPFFNAKQLEDNFAKKGLSLDEMVTLSGAHSIGVSHCSSFSNRLYTFNSTHPQDPSMDTRYAAFLKTRCPRPSSTRATRDPTMPLDIVTPNTLDNTYYKELINHRGLLTSDQTLLDSSSTAGIVWNNVLRPSTWAAKFASAMVHMGSIDVMTGTEGEIRKNCKVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (intron 1).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACTACGTTCATCACCTACCTACTTCTCATTTTTGCCATTTCTATGACCACATTAGTCTCATCAGCATCACTTCAAGTTGGTTTCTATCGATCAACATGTCCATCAGCTGAGTTA
ATTGTGAGAAGAGCTGTTAAAAGTGTTGTATCACGGAATCCTGGCATAGCTGCTGGCTTGATTAGGATGCATTTCCATGATTGCTTTGTTAGG
GTACGTTCATCTCATATCTGCACTTTC
TCAAGGACCTTTGTCATTGAGGTGTACGTAACTAATAATTAATACTAATATGTTTGGTTGTATATATATTTCTTTTGCAGGGATGTGATGCATCAGTGTTACTTGATTCATCAACACCAG
AAAATCCTTCAGAGAAAGAACATCCTGCGAACAATCCAAGTTTACGTGGCTTTGAAGTCATCTATGAGGCAAAGGATCTAATTGAAGCGATATGTCCCCAGGTTGTGTCGTGTGCAGACA
TTATTGCCTTTGCGGCTCGTGATAGTGCATGTCAAGTTGGGGGGATCAACTATGCAGTACCAGCTGGACGACGTGATGGGCGTGTTTCCCTTAAAGGTGAAGTCAGCCAAAACCTCCCAC
CACCTTTCTTCAATGCCAAGCAGCTTGAAGACAACTTTGCGAAGAAAGGTTTGTCTCTAGACGAGATGGTGACACTTTCGGGTGCACACTCCATTGGAGTCTCCCATTGCTCTTCTTTCT
CTAACCGTCTCTACACCTTTAACTCCACCCATCCACAAGATCCTTCGATGGATACTAGGTATGCTGCGTTCCTAAAAACTAGGTGTCCTCGACCATCCAGCACCAGAGCTACCCGAGATC
CAACAATGCCACTTGATATTGTAACACCTAATACATTAGACAACACATACTACAAGGAATTGATAAACCATCGAGGTTTATTGACTTCAGATCAAACTCTTCTTGACAGTAGCTCAACAG
CAGGGATTGTGTGGAATAATGTATTACGCCCTTCGACTTGGGCTGCCAAGTTTGCATCGGCAATGGTACACATGGGTTCCATCGATGTTATGACAGGCACTGAAGGGGAGATCAGGAAGA
ACTGCAAGGTTGTCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACTACGTTCATCACCTACCTACTTCTCATTTTTGCCATTTCTATGACCACATTAGTCTCATCAGCATCACTTCAAGTTGGTTTCTATCGATCAACATGTCCATCAGCTGAGTTA
ATTGTGAGAAGAGCTGTTAAAAGTGTTGTATCACGGAATCCTGGCATAGCTGCTGGCTTGATTAGGATGCATTTCCATGATTGCTTTGTTAGG
GGATGTGATGCATCAGTGTTACTTGAT
TCATCAACACCAGAAAATCCTTCAGAGAAAGAACATCCTGCGAACAATCCAAGTTTACGTGGCTTTGAAGTCATCTATGAGGCAAAGGATCTAATTGAAGCGATATGTCCCCAGGTTGTG
TCGTGTGCAGACATTATTGCCTTTGCGGCTCGTGATAGTGCATGTCAAGTTGGGGGGATCAACTATGCAGTACCAGCTGGACGACGTGATGGGCGTGTTTCCCTTAAAGGTGAAGTCAGC
CAAAACCTCCCACCACCTTTCTTCAATGCCAAGCAGCTTGAAGACAACTTTGCGAAGAAAGGTTTGTCTCTAGACGAGATGGTGACACTTTCGGGTGCACACTCCATTGGAGTCTCCCAT
TGCTCTTCTTTCTCTAACCGTCTCTACACCTTTAACTCCACCCATCCACAAGATCCTTCGATGGATACTAGGTATGCTGCGTTCCTAAAAACTAGGTGTCCTCGACCATCCAGCACCAGA
GCTACCCGAGATCCAACAATGCCACTTGATATTGTAACACCTAATACATTAGACAACACATACTACAAGGAATTGATAAACCATCGAGGTTTATTGACTTCAGATCAAACTCTTCTTGAC
AGTAGCTCAACAGCAGGGATTGTGTGGAATAATGTATTACGCCCTTCGACTTGGGCTGCCAAGTTTGCATCGGCAATGGTACACATGGGTTCCATCGATGTTATGACAGGCACTGAAGGG
GAGATCAGGAAGAACTGCAAGGTTGTCAACTAG

Retrieve as FASTA