Entry information : AcoPrx21 (AcoGoldSmith_v1.008203m)
Entry ID 8455
Creation 2011-08-09 (Bruno Savelli)
Last sequence changes 2011-10-03 (Bruno Savelli)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-01-05 (Christophe Dunand)
Peroxidase information: AcoPrx21 (AcoGoldSmith_v1.008203m)
Name (synonym) AcoPrx21 (AcoGoldSmith_v1.008203m)
Class Class III peroxidase    [Orthogroup: Prx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx21
start..stop
S start..stop
AfpPrx01 693 0 1..332 1..332
PtrePrx01 611 0 2..332 1..331
PtremPrx01 611 0 2..332 1..331
PtralPrx01 609 0 2..332 1..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 734891..735124 234 N° 2 735236..735424 189 N° 3 735662..735827 166 N° 4 736066..736475 410
join(734891..735124,735236..735424,735662..735827,736066..736475)


exon

Literature and cross-references AcoPrx21 (AcoGoldSmith_v1.008203m)
DNA ref. Phytozome 12:   scaffold_5 (734891..736475)
Protein sequence: AcoPrx21 (AcoGoldSmith_v1.008203m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   333 (307)
PWM (Da):   %s   37530.06 (34726.6) Transmb domain:   %s   i7-25o
PI (pH):   %s   7.56 (7.33) Peptide Signal:   %s   cut: 26 range:26-332
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVSSKALCFFVLFSFSAIALQSAFADHEEDVGLVMNFYKDTCPQAEEIIREQVKLLYKRHKNTAFSWLRNIFHDCAVQSCDASLLLDSTRRELSEKETDRSFGLRNFRYLDTIKEAVERECPGVVSCADILVLSGRDGVVALGGPYIPLKTGRRDGRRSRAEILEQYLPDHNESISSVLDKFGAMGIDTPGVVALLGAHSVGRTHCVKLVHRLYPEVDPALHPDHVEHMLHKCPDAIPDPKAVQYVRNDRGTPMILDNNYYRNILDNKGLLQVDHQLANDKRTKSYVKKMAKSQDYWASEFSRALTILTENNPLTGTQGEIRKQCNVVNKHH*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST available.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTCTTCCAAAGCTCTTTGTTTCTTTGTTCTTTTTTCCTTCTCAGCTATTGCTCTCCAGTCTGCTTTTGCAGACCATGAAGAAGATGTTGGTCTTGTCATGAACTTTTACAAGGAC
ACATGTCCTCAAGCTGAAGAAATCATCAGAGAGCAAGTCAAGCTTCTCTATAAACGCCACAAGAATACTGCATTCTCATGGTTGAGGAACATCTTCCATGACTGTGCTGTTCAG
GTAAAC
ATACCAAGAACTCTTCAAGACTTTTTTTTAGGTCTGTTTGTTTATATTTTGGATTTTTCTTCAAGATTTGCTAATGGGGGTTCTTCTGTCTTTCTTTTTGAATAGTCTTGTGATGCTTCC
CTATTACTGGACTCTACAAGAAGGGAATTATCTGAGAAGGAGACAGACAGGAGCTTTGGACTTAGAAACTTCAGATATCTTGACACCATTAAAGAAGCTGTGGAGAGGGAATGCCCTGGA
GTTGTTTCTTGTGCTGATATCCTTGTGTTGTCTGGAAGAGACGGCGTTGTTGCG
GTAATGAATCAACCTGTACATTTGATTATGATTTACACAGTTTCAGTTGGTTTTTCTTTTATAAAA
CTATTTCTTTCACATTATCTTAGATCTGAGTTGCATGTAGTATTTGTACCTAATTTAGAGTTTCTTCAATTTATGTCCCTTTTCATTAAAATGATGTAGCTTTCTATCTAGTTGGTACTA
GACTACTATCACCATAATAACTGATGTCTTCTTATTCACTATTTGTTTCAGCTTGGTGGTCCATACATCCCTCTCAAGACAGGAAGAAGAGATGGAAGGAGAAGCCGTGCCGAGATTCTT
GAACAGTATCTTCCCGACCACAATGAAAGCATCTCCTCTGTCTTGGATAAGTTTGGAGCCATGGGCATTGATACTCCAGGAGTTGTTGCTTTGCTAG
GTATATTCATACACTATCAACAC
ATAATTGGAATTAAAAGGACAAGACATGCATATGTCATTGGGTTCTGTATGCGCTTCCAAATGGCATCAACATTGATAGCACAACACCATCCTCCCACTACACAATCCAAAGTCAACTCA
TCTAACTTATAATGGAGAATGGGTTTTTTGAATCAATTCATCAATTCAATTAGCCTGATGAATTGGCTCTAACATCACTATTTTGACTTTTACAGGTGCTCACAGTGTTGGTAGGACTCA
CTGTGTTAAGCTAGTTCACCGTTTGTACCCAGAGGTCGACCCTGCTCTCCACCCTGACCATGTTGAGCACATGCTTCACAAGTGCCCCGACGCAATCCCTGACCCAAAGGCTGTTCAATA
CGTGAGGAATGATCGTGGAACACCAATGATACTAGACAACAACTACTACAGAAACATCTTGGACAACAAGGGATTGCTCCAAGTAGATCACCAGCTAGCAAATGACAAGAGGACTAAGTC
TTATGTGAAGAAGATGGCAAAGAGCCAGGACTACTGGGCATCAGAGTTTTCAAGAGCCCTCACCATCCTTACTGAAAACAACCCACTCACTGGAACTCAGGGTGAGATCAGAAAGCAATG
CAATGTTGTCAACAAGCACCACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTCTTCCAAAGCTCTTTGTTTCTTTGTTCTTTTTTCCTTCTCAGCTATTGCTCTCCAGTCTGCTTTTGCAGACCATGAAGAAGATGTTGGTCTTGTCATGAACTTTTACAAGGAC
ACATGTCCTCAAGCTGAAGAAATCATCAGAGAGCAAGTCAAGCTTCTCTATAAACGCCACAAGAATACTGCATTCTCATGGTTGAGGAACATCTTCCATGACTGTGCTGTTCAG
TCTTGT
GATGCTTCCCTATTACTGGACTCTACAAGAAGGGAATTATCTGAGAAGGAGACAGACAGGAGCTTTGGACTTAGAAACTTCAGATATCTTGACACCATTAAAGAAGCTGTGGAGAGGGAA
TGCCCTGGAGTTGTTTCTTGTGCTGATATCCTTGTGTTGTCTGGAAGAGACGGCGTTGTTGCG
CTTGGTGGTCCATACATCCCTCTCAAGACAGGAAGAAGAGATGGAAGGAGAAGCCGT
GCCGAGATTCTTGAACAGTATCTTCCCGACCACAATGAAAGCATCTCCTCTGTCTTGGATAAGTTTGGAGCCATGGGCATTGATACTCCAGGAGTTGTTGCTTTGCTAG
GTGCTCACAGT
GTTGGTAGGACTCACTGTGTTAAGCTAGTTCACCGTTTGTACCCAGAGGTCGACCCTGCTCTCCACCCTGACCATGTTGAGCACATGCTTCACAAGTGCCCCGACGCAATCCCTGACCCA
AAGGCTGTTCAATACGTGAGGAATGATCGTGGAACACCAATGATACTAGACAACAACTACTACAGAAACATCTTGGACAACAAGGGATTGCTCCAAGTAGATCACCAGCTAGCAAATGAC
AAGAGGACTAAGTCTTATGTGAAGAAGATGGCAAAGAGCCAGGACTACTGGGCATCAGAGTTTTCAAGAGCCCTCACCATCCTTACTGAAAACAACCCACTCACTGGAACTCAGGGTGAG
ATCAGAAAGCAATGCAATGTTGTCAACAAGCACCACTAG

Retrieve as FASTA