Entry information : AcoPrx26 (AcoGoldSmith_v1.008320m)
Entry ID 8456
Creation 2011-08-09 (Bruno Savelli)
Last sequence changes 2011-10-03 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-07 (Achraf Jemmat)
Peroxidase information: AcoPrx26 (AcoGoldSmith_v1.008320m)
Name (synonym) AcoPrx26 (AcoGoldSmith_v1.008320m)
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx26
start..stop
S start..stop
AfpPrx13 676 0 1..329 1..329
NtPrx31-1A 460 2e-164 4..329 5..327
AcoPrx27 453 1e-161 9..329 10..328
RcPrx31 449 7e-160 5..329 6..335
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3962445..3962660 216 N° 2 3962763..3962954 192 N° 3 3963049..3963214 166 N° 4 3963766..3964181 416
join(3962445..3962660,3962763..3962954,3963049..3963214,3963766..3964181)


exon

Literature and cross-references AcoPrx26 (AcoGoldSmith_v1.008320m)
DNA ref. Phytozome 12:   scaffold_7 (3962445..3964181)
Protein sequence: AcoPrx26 (AcoGoldSmith_v1.008320m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (304)
PWM (Da):   %s   36109.71 (33220.3)  
PI (pH):   %s   5.61 (5.14) Peptide Signal:   %s   cut: 26 range:26-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGTSYAHFTVPVFCLLLFSSRLAFSQLDYNFYAYTCPHVENIVSYGLWKAIQKETRIAASLLRLHFHDCIVDGCDASILLDDTKNFNGEKNAGPNRGSARGYEVIDDIKAEVEKACPSTVSCADILTLAATQAVHCAGGSYWPVPLGRRDSTTASQKAANEQIPSPFESLENITAKFVSKGLDLNDVVVLSGAHTIGFAQCFTFRRRLFNFGGSGKPDPTLDSSMLKKLQTVCPNGDMTNTNNKIAPLDSQTINQFDNLYYKNVMSNTGLLESDQVLLQDPNSASMVQYYSMYPSLFSDDFATSMVKLGNVGVLTGEEGEIRKNCHFVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTACTAGTTATGCCCACTTCACTGTCCCTGTGTTCTGCCTCTTATTGTTTAGTAGTCGCCTTGCCTTCTCCCAACTTGATTATAACTTCTATGCTTATACATGTCCTCATGTGGAA
AACATTGTTAGCTATGGTCTATGGAAGGCTATTCAAAAGGAAACGAGGATTGCAGCATCTCTTCTTCGACTGCACTTTCATGATTGTATTGTTGAT
GTAATGATCGATCATCTGTTTTTT
TTTTTATCAATCAACTTCATTGCCAAATTACATTATACTTAACTAGAACTTATAGTGGCCTCGCCTTTTGTGTTCTAGGGATGTGATGCATCAATACTACTCGACGATACAAAAAACTTT
AACGGGGAAAAGAACGCTGGTCCAAACCGTGGTTCAGCTAGAGGATACGAGGTCATTGACGATATTAAGGCTGAAGTAGAAAAGGCATGCCCTTCCACTGTCTCTTGTGCTGATATACTG
ACTCTTGCAGCAACCCAGGCAGTACATTGT
GTAAGAAACATTCTATTAAATTTTCCTCATTAATATTTTGATAGCTAGCTTGGCCTTTGTTCTTAGGCTGAAAGTTGTTCATTTCTGTGT
GAAGGCAGGAGGGTCTTACTGGCCAGTACCATTAGGTCGGCGAGATAGCACAACGGCAAGCCAAAAAGCAGCTAACGAGCAGATACCGTCACCATTTGAGTCTTTAGAAAATATTACAGC
AAAGTTTGTCTCCAAGGGTCTTGATTTGAATGATGTGGTGGTGCTTTCAG
GTTCTTATCCTAGACCTTTCTTCAATTCTGACTTCTTTAATATATGATATTGCATTTTAAGGATTAACTG
TAGACTATGCATGAAATAAGATAGAAAATATATAGGCGTAACATATGAAAATGTAGCATGCATAAAAGAGATACTTCAAACAGAATTTGGAATATATAGGCCATATGAAAATGCAGATGG
ATGCGGATCACAGGATGTGGTACTAACTTCGTCACATAAATGATTAACTACGTACATGCACAGAACAGTATGGTCATGTTTCGGATTTTGCCGCAGTTCAGAAGATCTGCGGTAGGCTAC
AGCCACCAGCCAACCGTAATTGCAGCCTGGAATATTTTGTGGTATAAAAGCCTAAATGACTAAGTTATGCCTCTCTGCGGTTTCAACCCTATTGTTTTGTGTATTAATCTTGTCAGGCAG
GGCACATCGAGTAGCTATCTCTATAATTTGAATTTGTTATGAGTCCTAGTGATAGTAAGTTTTTCATTTGATACACATATATAAAGCTTAATTTTAGTGTTGCCGTTTCCATATATTTCA
GGTGCACACACCATTGGTTTTGCACAATGCTTCACCTTCAGGAGAAGGCTATTCAACTTTGGTGGATCAGGCAAACCTGATCCGACCCTTGATTCATCAATGCTCAAGAAGCTGCAAACA
GTGTGCCCAAACGGAGATATGACGAATACAAATAACAAAATTGCTCCTTTGGACTCTCAGACTATAAATCAATTCGATAACCTATATTATAAGAACGTCATGAGCAACACAGGCCTTCTT
GAATCAGACCAAGTGCTTCTCCAGGATCCTAATTCTGCCTCCATGGTTCAATACTACAGTATGTATCCTTCTCTGTTTTCTGACGACTTTGCTACATCCATGGTGAAGCTGGGAAACGTT
GGCGTACTAACAGGAGAAGAAGGGGAGATAAGAAAGAACTGTCATTTCGTTAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTACTAGTTATGCCCACTTCACTGTCCCTGTGTTCTGCCTCTTATTGTTTAGTAGTCGCCTTGCCTTCTCCCAACTTGATTATAACTTCTATGCTTATACATGTCCTCATGTGGAA
AACATTGTTAGCTATGGTCTATGGAAGGCTATTCAAAAGGAAACGAGGATTGCAGCATCTCTTCTTCGACTGCACTTTCATGATTGTATTGTTGAT
GGATGTGATGCATCAATACTACTC
GACGATACAAAAAACTTTAACGGGGAAAAGAACGCTGGTCCAAACCGTGGTTCAGCTAGAGGATACGAGGTCATTGACGATATTAAGGCTGAAGTAGAAAAGGCATGCCCTTCCACTGTC
TCTTGTGCTGATATACTGACTCTTGCAGCAACCCAGGCAGTACATTGT
GCAGGAGGGTCTTACTGGCCAGTACCATTAGGTCGGCGAGATAGCACAACGGCAAGCCAAAAAGCAGCTAAC
GAGCAGATACCGTCACCATTTGAGTCTTTAGAAAATATTACAGCAAAGTTTGTCTCCAAGGGTCTTGATTTGAATGATGTGGTGGTGCTTTCAG
GTGCACACACCATTGGTTTTGCACAA
TGCTTCACCTTCAGGAGAAGGCTATTCAACTTTGGTGGATCAGGCAAACCTGATCCGACCCTTGATTCATCAATGCTCAAGAAGCTGCAAACAGTGTGCCCAAACGGAGATATGACGAAT
ACAAATAACAAAATTGCTCCTTTGGACTCTCAGACTATAAATCAATTCGATAACCTATATTATAAGAACGTCATGAGCAACACAGGCCTTCTTGAATCAGACCAAGTGCTTCTCCAGGAT
CCTAATTCTGCCTCCATGGTTCAATACTACAGTATGTATCCTTCTCTGTTTTCTGACGACTTTGCTACATCCATGGTGAAGCTGGGAAACGTTGGCGTACTAACAGGAGAAGAAGGGGAG
ATAAGAAAGAACTGTCATTTCGTTAATTAG

Retrieve as FASTA