Entry information : AcoAPx01 (AcoGoldSmith_v1.005584m)
Entry ID 8459
Creation 2011-08-10 (Qiang Li)
Last sequence changes 2011-12-13 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-14 (Qiang Li)
Peroxidase information: AcoAPx01 (AcoGoldSmith_v1.005584m)
Name (synonym) AcoAPx01 (AcoGoldSmith_v1.005584m)
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoAPx01
start..stop
S start..stop
AfpAPx05 805 0 1..394 1..424
StAPx06 647 0 27..394 54..423
NtAPx01-1B 642 0 27..394 66..435
LeAPx08 640 0 27..394 52..421
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1352632..1352715 84 N° 2 1352891..1353040 150 N° 3 1353414..1353534 121 N° 4 1353605..1353705 101
N° 5 1353834..1353921 88 N° 6 1354382..1354449 68 N° 7 1354534..1354620 87 N° 8 1356442..1356516 75
N° 9 1356606..1356683 78 N° 10 1356773..1356877 105 N° 11 1357595..1357669 75 N° 12 1357961..1358113 153
join(1352632..1352715,1352891..1353040,1353414..1353534,1353605..1353705,1353834 ..1353921,1354382..1354449,1354534..1354620,1356442..1356516,1356606..1356683,13 56773..1356877,1357595..1357669,1357961..1358113)


exon

Literature and cross-references AcoAPx01 (AcoGoldSmith_v1.005584m)
DNA ref. Phytozome 11:   scaffold_14 (1352632..1358113)
Omic ref. Genevestigator:   At4g21961 [Other strain]
Protein sequence: AcoAPx01 (AcoGoldSmith_v1.005584m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   394
PWM (Da):   %s   43408.96 Transmb domain:   %s   o374-393i
PI (pH):   %s   7.39
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MACLSTTYSASTHSHHYHLHSSTRKPIAKLQRRSMSHTISVGRIAVVPTCFASNTDQLKSAKEDIKVLLKTTFCHPIMVRLGWHDAGTYNKNIEEWPQRGGANGSVRFEIELKHAANAGLVNALKLLQPIKEKYPGVTYADLFQLASATAVEAGGPKIPMKYGRVDVSEPEQCPEEGRLPDAGPPTPASHLRDVFYRMGLSDDIVALSGAHTLGRSRPERSGWGKPETKYTKDGPGAPGGQSWTIQWLQFDNSYFKDIKEKRDEDLLVLPTDAVLFEDPSFKEYAEKYAVEQETFFNDYAESHAKLSNAGAKFDPPEGLSIDDGSANGVPEKFVAAKYSSGKRELSAEMKKKIRAEYEGFGGSPDKPLQSNYFLNIIVVIGVLAILTYFFGN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (Extra PS has been removed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGCTTGAGTACTACTTATTCTGCTTCTACTCATTCTCATCACTATCATCTTCACTCTTCAACAAGAAAACCAATAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGTGTGTTTGTTTTCTCTATTGATTTCTGATT
GAATTTGTTTTGTTTGTAGAAACTTCAAAGAAGATCTATGTCTCACACTATCAGTGTTGGTCGGATTGCCGTTGTTCCGACTTGCTTTGCTTCGAATACAGATCAATTGAAAAGTGCTAA
AGAAGATATCAAAGTTCTTCTCAAGACTACTTTCTGTCATCCGATCATG
GTATTTCAATTATTTTACAAATTGATCGTAGTAGTAGTTGTTATTATATAAAGTTTTTGGGTATTTGATTA
ATTTCAATTTGAAATAGTGATTTCTAATTTTTTTTTTTAGGGTTCTGTGGAGTTAGTGTTTTCAATTTGATCTTAATCGAAATAGGATTTTCAGTCAAGATTGTCACATTGAAAATGAAA
TGAATTGCTAATACTTCTTTTAGCTCTAGTCACATTGCTAATCTCAATTGTTCACATTTATTTAATAGTTTAATGTGTAGTGAAACATAGTAGCTGTTTTGCTTGGATTTTGTTAATATG
TATGGTTTGAATAGATAGAATTATTGGAAGGAGAAGTTGTGTTTATAGTTTTTGTATTATAGGTTCGCTTGGGATGGCATGATGCTGGTACGTATAACAAAAATATTGAAGAGTGGCCAC
AAAGAGGTGGAGCTAATGGAAGTGTTAGGTTTGAGATTGAGTTGAAACATGCAGCTAATGCTG
GTAATTGTTCTTAGCTGTATCGAGTTTTACTTGGTTGGTGATGATGTGGCTTAATTA
GCTTTTATCATAGGTCTTGTAAACGCACTGAAGCTTCTTCAGCCTATCAAGGAAAAGTATCCAGGTGTCACATATGCAGACTTATTTCAGTTGGCCAGCGCTACAGCTGTGGAGGTCTTT
CCTTAACAAAAATGCAGTTAATTAAAAATAATGTCTATTTGCTGGAACAAACAAATAGATTTTTCTATTTACTTCTTGCATGGAAACTTTGCTCACAAAGTCAAGTTGTCAACATTTTTC
AGGAAGCTGGAGGCCCCAAAATCCCTATGAAATATGGTAGAGTGGATGTTTCCGAACCTGAACAATGCCCAGAAGAAGGGAGACTTCCGGGTAAGTCATTATTCCTAGTTGGGGGGTGTT
TATGTCTGCATGTGCAAGGTCCATCAGTAAAATGCATTTTAATTATGAACTAATACTCAAGCCTCAAGGGTTCTACATCTGAAAGTTCATTTCAGTTTAAAGATCTGCCTATATACCTTA
AGTTCGGACCCATTCTGAATCCAGTGGTTAATTCCAATCTGTTGTTAGGATTATGGTGCCTTGCTTAGGTTGACTAACAATTTTTCCAGAATCCATTTTGCATTTGGTGATACTTTGTCT
ATATGATATTATTCTGTTGTATTGCAACCTTTACTTGTAGCACATATTATAGCAAACTTGACTGTTAACGTTTGGTATTTTACTTTGTCTATTTACTTGATCATGTTTCCTACTCTTAAA
TAACAAACAGTTGAATAGTTGGATCACAATCAGTTACAGCTAACATCTGGAGTTCCCATTCCATTTTTAGATGCGGGACCCCCTACGCCTGCTTCACATCTACGTGACGTCTTCTATAGG
ATGGGTTTAAGCGACAAG
GTTACACTCATCATGATTCTTTAGTTTCATCCTTCTATAGTTCTATGGCTTCTTGCAACTGAACATTTGCTGTTTGACTTGTAGGATATAGTTGCATTATCT
GGTGCACACACATTGGGAAGGTCTAGACCAGAGCGTAGTGGTTGGGGGAAGCCAGAAACAAAGTATACG
GTATATTAATGAACACCATCCGTTTTGAAATAGTTTTCAGTATTTCTTTCA
TCTTCTCAGTTTTGATCTTTCACTAATGACCAATGAAACAGAAAATAGAAATAAATAAAAAACACTATCTTAAAACAAAAGAAGGACCAGTCAATTTTTATTTCTTGACCTGAACTCCGA
TAAAGGTAATCATTGATCTAATGCAAAACATACATATGATTAGCATACGATTCTGCTGGAACTTGTTTTGGTCGAGGAGCATGTATCCAGTGCTTGTTTAAGTACTAACATCTAACTTTG
GTTTCCGTAAATTTACACCAGCAAGAGCTTAGAATATATAGAGTATATATGGACCAGATTTGGAGATTGCCTTGCGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTTTCGGTTCGGTGTCGGTTAGTAAAGTTCGGTTGTAAT
AAAATCCGAACCGATCCGAAGTATACTAATAAAGTTCTTATCTTTATTACCCATCTGACCATCTCAATCAACCATAGATTTTCAATTTTTATTGAAGGTACTGAAGCTGAAAGATCTTGA
AATCTAAACCATTGCCATGGAAGAAAAACTTTAGTTCTTCACTTGTTGGTTGCTAGGTTGAAGATGGAGGTGATTTAGGTTTATTCTAACTATATATTAATGGATCCCAAATGTTTGTGT
TAGACTATTGGGTATCCAAAGAGAAAACAAACTACACCAAAGCCCAAACTTATAAAAATCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATCTGACCCGAACCGGACCGAATCCACCCCTACTTGCGGGTGT
TAGTCAAGAAGCTATAGAAGTTCAGTGATAATTCCAGTTGTTTCATCATTGGGAGTTTGGTACCAAGAAGATTTTTCTATAGGATGCCAATAGCAGAATAGCCTTCAACCAAATTTGATA
TGAGTCAACAACTTCCTGTGGTGCTTATGTCAAAAATCACTGGAACTTATTGGTGTGGTGAAAAGGATGACTTTGAAAATTAGCATGTCAGTAAATTATATAAACTGGATCGTCCGCTCT
CCTTGAAGGGTTTTAGAAATAATGTGCTCTATTTCAGTTTTCAATGCTCTTTTTGGAGAGTAAAAAATGTGTGGTCATGATCTTGATGTGTTTACATCAGTTCACATCAGGTCATAGCTG
ATAACAGTTCTTGAATGCTTTCAATGCATTTATGTCATTGTCTGAAGGACGGAGCAACGGGTTTGACCTGGCATCTAGGTCATGCTTTTAAACCTTTGTTTCAGAGGGGTAAACAAAATT
AATAACCAGTTGACTCACTCATCCCGACTTATTAAGGTGTTGGTATGACCAAATATTTTCTCCATTTATTCTGTAGTTTTACATTGTATCTAACACTTTTTAAGATGTGTAATTTTGTAT
ACCTTGGTACTACTCATAGTATATATTGTATACCTTGGTATTACTCCTAGTATATATTGTACATGCTTAGCATACTTACAATTTTTCATTTTTGTTAGTACTATTTGAGTAAACTGAAAT
AGTTTTAAACTTTGTTCAATCTTACCAAGGGTCAAACTTTGTTCAATCTTACTAAGATGTAATTGCTCATCGTACATTTACATGTGACAGAAAGATGGACCAGGAGCTCCAGGGGGGCAG
TCATGGACCATCCAGTGGTTGCAGTTTGATAATTCCTATTTCAAA
GTAAGTGTAACACTCCTAAATCATTTAAACATTTGCAGTGTTGATCAATCTAGATTTGATAATGGATTAATGGGT
GGTTGATCATCTAGGACATTAAAGAGAAAAGAGATGAAGATTTGTTGGTCTTGCCAACTGATGCTGTTCTTTTTGAAGATCCCTCGTTCAAGGTGAAGAAAAGGTTTTCAATGTCTATTC
CATCAAATTGAATTGAGACAGACCAACATTTTCTTATTTGAAAATTTGATTTGTTTTGCAGGAATATGCAGAGAAATACGCAGTAGAACAAGAGACATTTTTTAACGACTATGCAGAATC
TCATGCCAAATTGAGCAATGCTGGTGCCAAATTTGACCCTCCTGAG
GTTTCTATATATTCCCCTAGTTTTTTATTTTATTATTCACAAATGCTTAAAACGAATAAATCACATTGTAATCA
TTATGTTTCTTACACTTAATTGTTGGGATTGGTTATAGTTAAGATGATGACAAACATGCTAATCTTGTCTGGGTAGTGTTTATATCCATCTCTTCGATAAGGATGCTAATAATTAGCTTG
AAAAGGTTTTTCAGTGATAGGATTGGATCTTCTCAAAACCTGTATGTATATCTCGTTTGTATATGAAATATATCGACATTTGAAAATGAATAGCAAAGTACCTTTATATTAGCAAGAATG
CATTTTCTATGTTGTTATTATCATTTCTGAATAAAATATAAAGAGAATTATTGATCGTATGTGGTGAGCTCATTGATCGTTCACAAGGGATTTCTAGAGGTTACATATGCTATGGACTGT
GGTTTATCCACACTAGAGCTTTACTAATTCCACACTGCTCAAGTATTATGCATAAATTGGGAACCTAAATGGAATAAAGGAGCATTCCACCTGTAACCATCAAAGTTAATTCACTATTTA
TAAATCAGTGCAGTGGTCTATCCACATTAGAAATCTATTTTAAGAGCATCGTACTGAAGTAGTTTAATTTCATCTCTTAACTTTATCTCTGTGCTTCCTCTTTAAATTAATCCAGTTTGA
TGGTGAACAATCTAACTACTGGTTTTTGGAGCTATTTTATCAGGGTCTCTCAATAGATGATGGCTCCGCGAATGGTGTACCAGAGAAATTTGTCGCAGCCAAGTATTCGTCTGGGAAGGT
TGTTATCTTATCATTTTGGTATCAATATCTTTTTTCTAGAGTAATTCTTGCAGGAGAAAAGCTCACTGAGTATAGGAGAATCTCGTGAAAGAATTATAAAAGTGCATAATAAATGTTTTC
ATTACTTTCCATGGTTTATTGCAGGATTAAGAAACAGGAACATGTTATTGTTGTGCCAATGTCATTAATAACAAAAGATGAAGCTATTTCCAAACACTCAACTTACACATATAACTTTGA
AGTCAAACATGGAGAAAGGNNNNNNNNNNNNNNNNNNNNNGAATTGCAGAGAGAGCTGTCAGCTGAAATGAAGAAGAAGATCCGAGCGGAATATGAAGGATTTGGAGGCAGCCCAGATAA
GCCTCTTCAGTCGAACTACTTCTTGAATATCATTGTTGTGATTGGAGTTTTGGCTATTTTGACATACTTTTTTGGGAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGCTTGAGTACTACTTATTCTGCTTCTACTCATTCTCATCACTATCATCTTCACTCTTCAACAAGAAAACCAATAGCTAAACTTCAAAGAAGATCTATGTCTCACACTATCAGT
GTTGGTCGGATTGCCGTTGTTCCGACTTGCTTTGCTTCGAATACAGATCAATTGAAAAGTGCTAAAGAAGATATCAAAGTTCTTCTCAAGACTACTTTCTGTCATCCGATCATG
GTTCGC
TTGGGATGGCATGATGCTGGTACGTATAACAAAAATATTGAAGAGTGGCCACAAAGAGGTGGAGCTAATGGAAGTGTTAGGTTTGAGATTGAGTTGAAACATGCAGCTAATGCTG
GTCTT
GTAAACGCACTGAAGCTTCTTCAGCCTATCAAGGAAAAGTATCCAGGTGTCACATATGCAGACTTATTTCAGTTGGCCAGCGCTACAGCTGTGGAG
GAAGCTGGAGGCCCCAAAATCCCT
ATGAAATATGGTAGAGTGGATGTTTCCGAACCTGAACAATGCCCAGAAGAAGGGAGACTTCCGG
ATGCGGGACCCCCTACGCCTGCTTCACATCTACGTGACGTCTTCTATAGGATGGGT
TTAAGCGACAAG
GATATAGTTGCATTATCTGGTGCACACACATTGGGAAGGTCTAGACCAGAGCGTAGTGGTTGGGGGAAGCCAGAAACAAAGTATACGAAAGATGGACCAGGAGCTCCA
GGGGGGCAGTCATGGACCATCCAGTGGTTGCAGTTTGATAATTCCTATTTCAAA
GACATTAAAGAGAAAAGAGATGAAGATTTGTTGGTCTTGCCAACTGATGCTGTTCTTTTTGAAGAT
CCCTCGTTCAAG
GAATATGCAGAGAAATACGCAGTAGAACAAGAGACATTTTTTAACGACTATGCAGAATCTCATGCCAAATTGAGCAATGCTGGTGCCAAATTTGACCCTCCTGAGGGT
CTCTCAATAGATGATGGCTCCGCGAATGGTGTACCAGAGAAATTTGTCGCAGCCAAGTATTCGTCTGGGAAG
AGAGAGCTGTCAGCTGAAATGAAGAAGAAGATCCGAGCGGAATATGAA
GGATTTGGAGGCAGCCCAGATAAGCCTCTTCAGTCGAACTACTTCTTGAATATCATTGTTGTGATTGGAGTTTTGGCTATTTTGACATACTTTTTTGGGAACTGA

Retrieve as FASTA