Entry information : ZmDiOx[P]01
Entry ID 8467
Creation 2011-08-12 (Christophe Dunand)
Last sequence changes 2011-09-27 (Christophe Dunand)
Sequence status theoretical translation / pseudogene
Reviewer Not yet reviewed
Last annotation changes 2011-01-20 (Christophe Dunand)
Peroxidase information: ZmDiOx[P]01
Name ZmDiOx[P]01
Class Alpha-dioxygenase    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits No significant hits
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 125171124..125171255 132 N° 2 125171428..125171573 146 N° 3 125171733..125171868 136 N° 4 125171879..125171943 65
N° 5 125172248..125172370 123 N° 6 125172463..125172541 79  
join(125171124..125171255,125171428..125171573,125171733..125171868,125171879..1 25171943,125172248..125172370,125172463..125172541)


exon

Literature and cross-references ZmDiOx[P]01
Protein sequence: ZmDiOx[P]01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   10
PWM (Da):   %s   972.53  
PI (pH):   %s   4.11
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
SDRIDLAALE

Retrieve as FASTA  
Remarks Pseudogene.
[Incomplte: gap,mismatches,gap to querystart,gap to queryend, ]
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GATGATGGTCTTCTTTTGCATGAGGAGAATGGTGTGGCATTATTGGGCGATGTTCGCAATAGTTGGGTTGGGGTTTCGATCTTACAAGCTCTTTTTGTTAAGGAACGCAATGCAGTGTGT
GATGCAATAAAG
GTAAGAGAAGCATCACTATTATTATCTATTTGTTTAGTTTATATGAAGAATTTGATGTTCTTGATTTCTTTCCACCGTACCGATAAAGTTGTTGTTTATTAATTACCA
AGACATTAATTTTTTTATGCTAAAATATGAAGAAACAATTTAAAATGTTATTTTGATATCTCAGGAAGAACATCCCAACCTATCAGACGAAGAATTATATCGGTATGCTAGATTGGTCAC
TTCTGCTGTCATTGCAAAGGTTCACACTGTTGATTGGGCTGTCGAGCTTCTCAAGACTAAGACCATGAGAGCTGGAATGCACGCAAATTG
GTGAGGATATATTATCTCATTTTCTCATAT
TTGTTGAAAGAAAACAATTAACGCTGGTATTACTTTTCCAAGTGGAAATTTTATTTACATCTGCATATTCAAATTAATTAATTAGTGAGATTGTGTACAAATTTACCTCATTCTAATTCT
TTTGTGAAGGTATGGTTTATTGGGTAAGAAAATAAAAGATACATTTGGTCACATAGGAGGACCGACATTAGGTGGGCTCGTGGGGTTGAAGAAGCCGATCAACCATGGCGTACCTTATTC
TTTGACTGAAGAGTTTACCGGTGTT
TACAGAATGCACTCTTAAGCTCAGGGATCCGACCGGCCAACCCGATGCAAATAATTCCCCACCGTACCTGAAAGAGTGAGTAGACAATTTATATA
TGTTTGACATCCATTCCTCTCATTTTTATGTAGAATTAAATCAGACAGAAAAGAGTGATACAGATTATAAAGAATTGAACAAAAAAAAAGTTAAGACATTCTTCTATTAGATATCGACTC
TTACATAATGCATTACTGAACCAGACTTTAGACACTGAACTTGACACAACAAACAGCTACTTTTAAAAATGTAGCTAGAATGTATAAGTTTTCTGCTCGATTAGCACATTTTTAGTATAA
CTAACATAAACACTGACTCAATTCTTTCTTGTGTCGAAACATAGCATTGATATTGGAGAGTTGGTTGGTCTCAAGGGGGAAGAACAACTATCAAAAATAGGGTTTGAAAAGAAAATATTG
TCAATGGGATATCAAGCTTTGTGGTACANNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCGATTCTAGAGATTCGTCTTCAGGGACCTCATACCACAAAATTTGGATCGTACCAATCGATCTGACAGGATCGACCTTGCTGCCCTAGAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GATGATGGTCTTCTTTTGCATGAGGAGAATGGTGTGGCATTATTGGGCGATGTTCGCAATAGTTGGGTTGGGGTTTCGATCTTACAAGCTCTTTTTGTTAAGGAACGCAATGCAGTGTGT
GATGCAATAAAG
GAAGAACATCCCAACCTATCAGACGAAGAATTATATCGGTATGCTAGATTGGTCACTTCTGCTGTCATTGCAAAGGTTCACACTGTTGATTGGGCTGTCGAGCTTCTC
AAGACTAAGACCATGAGAGCTGGAATGCACGCAAATTG
GTATGGTTTATTGGGTAAGAAAATAAAAGATACATTTGGTCACATAGGAGGACCGACATTAGGTGGGCTCGTGGGGTTGAAG
AAGCCGATCAACCATGGCGTACCTTATTCTTTGACTGAAGAGTTTACCGGTGTT
ACTCTTAAGCTCAGGGATCCGACCGGCCAACCCGATGCAAATAATTCCCCACCGTACCTGAAAGAC
ATTGATATTGGAGAGTTGGTTGGTCTCAAGGGGGAAGAACAACTATCAAAAATAGGGTTTGAAAAGAAAATATTGTCAATGGGATATCAAGCTTTGTGGTACANNNNNNNNNNNNNNNNN
NN
ATTCGTCTTCAGGGACCTCATACCACAAAATTTGGATCGTACCAATCGATCTGACAGGATCGACCTTGCTGCCCTAGAA

Retrieve as FASTA