Entry information : ZmRboh0210-9
Entry ID 8468
Creation 2011-08-12 (Christophe Dunand)
Last sequence changes 2011-08-12 (Christophe Dunand)
Sequence status N/D
Reviewer reviewer name not stored
Last annotation changes 2011-08-12 (Christophe Dunand)
Peroxidase information: ZmRboh0210-9
Name ZmRboh0210-9
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmRboh0210-9
start..stop
S start..stop
ZmRboh02 979 0 134..745 245..911
ZmRboh02 192 2e-51 1..165 7..168
ZmRboh06 921 0 164..745 344..933
ZmRboh06 143 2e-35 63..166 164..267
ZmRboh06 55 0.00000006 1..60 7..59
TaRboh04 874 0 164..745 333..917
TaRboh04 141 6e-35 63..166 154..256
OsiRboh04 863 0 164..745 351..938
OsiRboh04 135 7e-33 63..166 172..274
OsiRboh04 47 0.00002 12..55 22..64
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 224384705..224384896 192 N° 2 224385188..224385323 136 N° 3 224385491..224385651 161 N° 4 224386085..224386777 693
N° 5 224386814..224387160 347 N° 6 224387231..224387324 94 N° 7 224389908..224390087 180 N° 8 224390112..224390424 313
N° 9 224390808..224390929 122  
join(224384705..224384896,224385188..224385323,224385491..224385651,224386085..2 24386777,224386814..224387160,224387231..224387324,224389908..224390087,22439011 2..224390424,224390808..224390929)


exon

Literature and cross-references ZmRboh0210-9
Protein sequence: ZmRboh0210-9
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   745
PWM (Da):   %s   84374.19 Transmb domain:   %s   o200-219i340-362o406-428i561-580o
PI (pH):   %s   9.73
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGDIVVEMSSSASAAAGSPQHERVIPHSGTLSKKSTRRSLRFVEPVTAAAPLPAPPLGASPSSAAAHALMGLRFISKAEGSAGWEAVKMRFRKLAINGLLHRSMFAECIGMKDTFVFAGVLFDALLRRRYILGDSIDEALMRELWEQISDTSFDARLLTFFDMSQILSRQDLRPRPEPNPLRRWHRRAQYFLEDNWRRVWVMLLWLCVCAGLFAWKFAQYRRRYVFQVMGYCVCVAKGGAETLKFNMALILLPVCRNTITWVRNHTGVGRVVPFDDNISFHMVVAAGITVGAGLHVVSHLTCDFPRLLRATDAAYAPLAQYFGVPRPRNYWWFVKGTEGWTGLAMLVLMAVAFTLAMPWFRRGELALPGPLKRLLAGPLKRLTDKLKLTDPLKPLKRLTGFNAFWYTHHCFVAVYALVLVHGHYLYLTHKWYKKSTWMYLAVPMVLYACERLTRALRSRVRAVKILKAEMHQAGKDMVMSLHFSKPQGFRYKSGQYIFVNCAAVSPFEWHPFSITSAPHDEYLSVHIKNLGDWTGALQNFPEVRIDGPYVAPAQDYKQYNVVLLVGQGIGVTPMISIIRDISNNMKQLDDDLEAGAGLGSFHTQRAYFYWVTPEQGSFEWFHDVMNEVAETDKNGVIELHNHCTSVYEEGDARSALISMIQSFNYAKHGVDVVSGTRVKTHFGRPNWRNVYEEIAENHQNQCVGVFYCGGARTLLKTLRELTQEFSRSRTTGTTKFEFHKENF

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGCGGGGACATCGTCGTGGAGATGTCGTCGTCTGCCAGCGCGGCGGCAGGGTCGCCGCAGCACGAGCGCGTGATCCCGCACAGCGGCACGCTGAGCAAGAAGTCCACGCGGAGGAGCTTG
CGGTTCGTGGAGCCCGTGACGGCGGCGGCTCCGCTGCCCGCGCCGCCGCTGGGCGCCTCGCCGTCCTCTGCC
GCCAACGACGACGACGACGACGACAACGACTACGTGGAGATCACCCTC
GACATGCGCGACGACTCGGTGGCAGTGGCCGTGGTGCACGGCGTGGAACCCGCCCACGCCGGGCCCGGCGATGACCCGAACGTGACGCAGGTGGTGGCGCGCCCGCTCGAGAACCACCGG
CGGTCCTCGTCCTACGGCCACTCCCTCACCCGGAACGCCTCGTCGCGGTTCAAGTTCAAGCAGGTGTCGCAGGAAATCCGCCGCGTCGCCGGCGGGCCACGGACCGACCTCTCCACCTCC
GCCGCCGCGCACGCGCTCATGGGGCTCAGGTTCATCAGCAAGGCCGAGGGCAGCGCCGGATGGGAGGCCGTGAAGATGCGCTTCCGCAAGCTCGCCATTAACGGACTCCTCCACCGCTCC
ATGTTCGCCGAGTGCATCG
GTGGGTGATCGAGAGTTAACTAACAATTAATCATCTTCCTCAGCTGAACCCTTCTGCCTGCCTGTTCTTTCGAGCGTTTTGGTGTGTTGCTACTTGCTTTG
CTTGCACGGTTGCACCAGGTTTGTCTTTGTTATATTAACCACATGGATGAACAACAAACACTACAGGGATGAAGGATACGTTCGTTTTCGCCGGCGTGCTGTTCGACGCGCTGTTGCGGC
GCCGCTACATCTTGGGAGACAGCATCGACGAGGCGTTGATGCGCGAGTTATGGGAGCAAATCTCCGACACCAGCTTCGATGCCCGGCTGCTGACCTTCTTCGACATG
TACTACGTCCTCA
TTGATTGATTTACTGCTACTAGTTGGAGTAATTAATGTTTTAAGCAGCAGCAGTAATTAATATGACCTGCAGGGTGGACAAGGACGCGGACGGCAGGATCACCGAGGAGGAGATCAGAGA
GGTAACCAACCGCCTTGCTTGTCGTCCTTCTGTGTGGAAATTCCTCTTCCATTCCTGCCCTCATGGATGTTGTATACGGCGAAAAAACGCATGCAGATCATCTCGCTGAGCGCGTCGACG
AACAGGCTGTCTAAGATCACGGCGAAGCAGGCGGCGGAGTACGCCCTGCTGATCATGGAGGAGCTGGACAGGGGCAACCTGGGCTACATCGACGTGTACGACCTGAAGACGCTGCTCCTC
CAGGCCCCCAGCAGCAGCCAGTCGGTGCGCATCGGCACCGCCACCAACGACGGCCGGAACATGAGCCAGATCCTGAGCCGCCAGGACCTCCGTCCGAGGCCCGAACCGAACCCTCTCCGG
CGCTGGCACCGGCGCGCGCAGTACTTCCTGGAGGACAACTGGCGGCGCGTGTGGGTGATGCTCCTGTGGCTGTGCGTCTGCGCGGGCCTCTTCGCGTGGAAGTTCGCCCAGTACCGGCGC
CGGTACGTGTTCCAGGTGATGGGGTACTGCGTGTGCGTGGCCAAGGGCGGCGCCGAGACGCTCAAGTTCAACATGGCGCTGATCCTGCTCCCGGTGTGCCGGAACACCATCACCTGGGTC
CGCAACCACACCGGCGTGGGCCGCGTGGTGCCCTTCGACGACAACATCAGCTTCCACATGGTGGTGGCCGCGGGCATCACCGTCGGCGCGGGGCTCCACGTGGTGTCCCACCTGACGTGC
GACTTCCCGCGGCTGCTCCGCGCCACGGACGCCGCGTACGCGCCCCTGGCGCAGTACTTCGGGGTGCCCCGCCCGCGCAACTACTGGTGGTTCGTGAAGGGCACGGAGGGGTGGACGGGG
CTCGCCATGCTCGTGCTCATGGCCGTCGCCTTCACCCTGGCGATGCCGTGGTTCCGCCGCGGGGAGCTCGCGCTGCCGGGCCCGCTCAAGCGGCTGCTGGCAGGGCCGCTGAAGCGGCTG
ACGGACAAGCTCAAGCTGACGGACCCGCTGAAG
CGGCTGACGTGCCAGCTCAAGCGGCTGACTGCAGGCCCGCTGAAGCGGCTGACGGGTTTCAACGCGTTCTGGTACACGCACCACTGC
TTCGTGGCGGTGTACGCGCTGGTGCTGGTGCACGGGCACTACCTGTACCTGACGCACAAGTGGTACAAGAAGTCGACGTGGATGTACCTGGCCGTGCCCATGGTGCTGTACGCGTGCGAG
CGCCTCACGCGGGCGCTCCGCTCCAGGGTCCGCGCCGTCAAGATCCTCAAGGCGGAAATGCACCAGGCCGGCAAGGACATGGTGATGTCGCTCCACTTCTCCAAGCCGCAGGGCTTCCGC
TACAAGAGCGGCCAGTACATCTTCGTCAACTGCGCCGCCGTCTCGCCGTTCGAATG
GTAATTAGCACCGTTGTTCTTCTCGTTCGTTGCAGAGGCTATAATAGCTAACAAACGTTCAATT
CTGCAGGCACCCGTTCTCCATCACGTCGGCCCCACACGATGAGTACCTGAGCGTCCACATCAAGAACCTGGGCGACTGGACCGGCGCGCTCCAGAACGTACGTACGCGCGCGCCATGCAT
GTCAACGTCAATTCGTCCGACCATGCACAGCCCGCCGAAGCTAACGTATGCGTGTGCAGGTGATCGTGCCGCCGAAGGAGGGCAATAGCGGTAGCGGGTAAACGAATGTGCTGACCGCTG
AAGCTAACGTATGTGTTGACGTCGGCAGCGCCATGGCCAACGACAACGACCCGAGGTGAGCAAAATCTCGCATCAAATATGAATTGTTTCCCTTGGTTCTTCGCCAACATATTCCGCTCC
CAATATTCTTTTAAGAAATCATTGATAAATAATAAATCTTCGCGTCCATGCGTGTGAATTCAGTCGGTTACTTACTTTAATTGGGTTAGGTAGGTACTGCGATTTGATATTCCAGGACGG
TTGACTTCCCTGCCTCTCCCCACCGACTCCGTTTTTTTCTTTGCAATATACTCCCTGGCCTCCACCGTCCATATATAGAGAAATATAATCCTAGTAAATAATCTGAAAACAATTCAAACT
CCGAGTAAAGTTATATATATACTAAACGGTACTACTTGTTAGACTCATGTTTAGGGTTAGGTTAGAGCTTTTTCTGTATTTACCTCATAATTACTCTTATTATGATGGGCTCGGCCCACC
TAACTCTTCATTATAATATACTCCCAACACTGGTTTTGGGTTTGAGTTTCCGATATGGTATCTACACTCCAACTATGTCTTCCTCTTCTGTCTCTTTCTCCCCATCTCCACTGAGCGTCG
CCAGCTCCCTATCCACACCTCCCAGGCCACATTGCACCTCGGCCATTCCTTCCCCTCGTGGCGATAGCACCTCGCTTTGCCATGCCTGTCACCTTGGGTGTCATACTCACTTACCCTTCT
CTTCTTCCATGTCCCGAGCTACTCACCGCTATGACCTTTGGGCGTCCCCTGTTCCAAGTATCTCTGGTTACCGGTACTATCTGGTCATCTTAATTGGATGGTTTCTCTTATTTTCTCTAG
ACTTTTCCTATACGGCTCAGTCTGACACCTTTCCCACTCTCCAGCACTTCTTCACCTATCTCCATTTAGTTTCGTCGCTCGTGCATGCCCTCTAGCGCGACAACGACCACAAGTTCGACT
ACTCCTCTCGCTCCTTTCTCTCCCACAACGTTCGGTTGTGACTCTTGTGTCCCTACACTTTCCCTCAGAATGGTCAGGCTGAATTCATTATTCGCACCACCACTAACTTTATTCGTCGAG
GCCAAGTTGGACACGTCCATGTTCATCCATCGGCACGACGATGACATCGTCTACCTCATCCTCTACATCGCGACATTATGCTCACGAAGTCTAGTGATGCCCTCCTTTAGCGCAAGATCA
ATGCCTTTTAGTGCGAGTTCACGATGAAGGACCTAGGCCCGCTCCACCACTTCCTCGGGATCACCGTGGAGTGACGGCCCTAGGGTCTCTTCCTTCACCAGCGGCAGTAAGCCCTCAGCA
TTCTGGAGCGGGCTGGCATATCCGATTGCAAGCCCTGCTCCATGCATATCGACACTCAGACAAAATTCTCCAATGACGACGATCTCCCAGTCACTGATGAGAAAGCCTATTGGTGCCTCA
CTGACGCACTCTAGTACCTAACATTTTCTTGGCCCAACATCGCCTACAGCATTCAATAGGTGTGCCTTCACATGAACAACCCACAAAAGCCCCCACCTCATCGCTCTCAAGCGGATTCTA
CGCTACCTTCGTGGCTCCATCAACTACGACCTTCTCCTTCGACCCTCCCCAACTTCAGAGCTAATGGTCTACACCGACGCCGACTGGGCTGGCTGCCCTGACACGCACCGGTACATATCC
GACTATGCCTTATTCCTGTAGGGCGCCAACCTCGTCTCCTAGGCCCGAATCGGTAGCCTGTCGTCTCCCACTCCAGTGCTGAGTCCGAGTACCACGATGTGGCCAAAAGAGTGGTCGAGG
CCTCCTAGCTTCGCCAGCTTCTCTAGGAGCTCCACAGTGCCCTCGAGCGCTCCACCCTCATCTACTGTGACAACATCAACGTGGTCTACCTTTCCAATAATCTTATGCAGCATCAGCGCA
CGAAGCACATGGAGATCGACCTTCACTTTGTCAGCGAGTGTGTCGTCGCTAGTGATGTTCACGTTCTTCGCGTCCCAACCACCTCACAATTTGCTGACATCTTCACAAAGGGGATGTCGT
TGAGTGTATTTACTGAGTTCTGATCTAGTCTCATCATCTATACAAGATAGAATTGCGACTGCTAGGGTGTTAGGCTCCTGTTTAGGGTTAGGTTAGGGCTTTCCTATATTTACCTAATTA
CCACTATTGTAATGGGCTTGGTCCACCTAACTCTTTATTATAATATACACTTTGTAGGGCTATGGTTTCAAACACTACTATATATATACACATACACAACTTTTTTGAAGACTGTCTTTT
TAAAATACAGGCACACTCTAATCTATGAGATAGAGGGAGTATTAGATTAGCTATAAAATATATTCTTATAATAAATTTACATTGTGGTATAAATGCTAATGCTATTTGCTATAGTTCTTC
AGTTAGTTTGAATTCCCATTTCATGAAATGGTTGTTTTGCAGCTTCCCCGAGGTGAGGATTGACGGCCCGTACGTCGCGCCGGCGCAGGACTACAAACAATACAACGTCGTGCTTCTGGT
AGGGCAGGGCATTGGCGTCACGCCCATGATCTCCATCATCAGAGACATCAGCAATAATATGAAGCAGTTGGACGACGACCTAGAGGCCGGCGCGGGCTTAGGA
TCCAGCGCCGACGCGCC
GTCGTCGTCCTTCCACACGCAGCGGGCCTACTTCTACTGGGTGACCCCGGAGCAGGGCTCCTTCGAGTGGTTCCACGACGTCATGAACGAGGTGGCCGAGACCGACAAGAATGGCGTGAT
CGAGCTCCACAACCACTGCACCAGCGTGTACGAGGAAGGGGACGCCCGCTCCGCACTCATCTCCATGATCCAGTCGTTCAACTACGCCAAGCACGGCGTCGACGTCGTGTCCGGCACCCG
CGTCAAGACCCACTTCGGCAGGCCCAACTGGCGCAACGTGTACGAGGAAATCGCGGAGAACCACCAAAACCAGTGCGTCG
GTAAGTTGTTTTGTTTTTGCACTCCTCACTCCTCAGTCGC
CATTCTACTTATGCTTTAGCAAGCTTAGAAGATGTTTGTTTGGGATTATAATATGCCCAGATTATATAATCTGATAAGTTTTGAACTAAATCTGTCCAGATTATATTTAGTTTAAAATTT
GTTGGATTATATAACCTAGGTGTAGATTATAATTCTAAATAAACACCCCTTAGTATACTATGCACGATAACCGCAACTAATTAGTACGTGTAGACGATGAGATAGATGATTATGAAAGAA
TTCTCATTGAATTGTTAACCGCAGGTAATAACGCATGACGTACTTCGTCATGTATACTTGCATTTCTAAATCAACACTGATATCTCTGGTCTTTGATATTCAGGAGTGTTCTACTGTGGC
GGTGCCCGGACCTTGCTAAAGACGCTGCGCGAACTCACGCAGGAATTCTCACGGTCACGGACGACAGGGACAACCAAGTTCGAGTTCCATAAGGAGAACTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGCGGGGACATCGTCGTGGAGATGTCGTCGTCTGCCAGCGCGGCGGCAGGGTCGCCGCAGCACGAGCGCGTGATCCCGCACAGCGGCACGCTGAGCAAGAAGTCCACGCGGAGGAGCTTG
CGGTTCGTGGAGCCCGTGACGGCGGCGGCTCCGCTGCCCGCGCCGCCGCTGGGCGCCTCGCCGTCCTCTGCC
GCCGCGCACGCGCTCATGGGGCTCAGGTTCATCAGCAAGGCCGAGGGC
AGCGCCGGATGGGAGGCCGTGAAGATGCGCTTCCGCAAGCTCGCCATTAACGGACTCCTCCACCGCTCCATGTTCGCCGAGTGCATCG
GGATGAAGGATACGTTCGTTTTCGCCGGCGTG
CTGTTCGACGCGCTGTTGCGGCGCCGCTACATCTTGGGAGACAGCATCGACGAGGCGTTGATGCGCGAGTTATGGGAGCAAATCTCCGACACCAGCTTCGATGCCCGGCTGCTGACCTTC
TTCGACATG
ATGAGCCAGATCCTGAGCCGCCAGGACCTCCGTCCGAGGCCCGAACCGAACCCTCTCCGGCGCTGGCACCGGCGCGCGCAGTACTTCCTGGAGGACAACTGGCGGCGCGTG
TGGGTGATGCTCCTGTGGCTGTGCGTCTGCGCGGGCCTCTTCGCGTGGAAGTTCGCCCAGTACCGGCGCCGGTACGTGTTCCAGGTGATGGGGTACTGCGTGTGCGTGGCCAAGGGCGGC
GCCGAGACGCTCAAGTTCAACATGGCGCTGATCCTGCTCCCGGTGTGCCGGAACACCATCACCTGGGTCCGCAACCACACCGGCGTGGGCCGCGTGGTGCCCTTCGACGACAACATCAGC
TTCCACATGGTGGTGGCCGCGGGCATCACCGTCGGCGCGGGGCTCCACGTGGTGTCCCACCTGACGTGCGACTTCCCGCGGCTGCTCCGCGCCACGGACGCCGCGTACGCGCCCCTGGCG
CAGTACTTCGGGGTGCCCCGCCCGCGCAACTACTGGTGGTTCGTGAAGGGCACGGAGGGGTGGACGGGGCTCGCCATGCTCGTGCTCATGGCCGTCGCCTTCACCCTGGCGATGCCGTGG
TTCCGCCGCGGGGAGCTCGCGCTGCCGGGCCCGCTCAAGCGGCTGCTGGCAGGGCCGCTGAAGCGGCTGACGGACAAGCTCAAGCTGACGGACCCGCTGAAG
CCGCTGAAGCGGCTGACG
GGTTTCAACGCGTTCTGGTACACGCACCACTGCTTCGTGGCGGTGTACGCGCTGGTGCTGGTGCACGGGCACTACCTGTACCTGACGCACAAGTGGTACAAGAAGTCGACGTGGATGTAC
CTGGCCGTGCCCATGGTGCTGTACGCGTGCGAGCGCCTCACGCGGGCGCTCCGCTCCAGGGTCCGCGCCGTCAAGATCCTCAAGGCGGAAATGCACCAGGCCGGCAAGGACATGGTGATG
TCGCTCCACTTCTCCAAGCCGCAGGGCTTCCGCTACAAGAGCGGCCAGTACATCTTCGTCAACTGCGCCGCCGTCTCGCCGTTCGAATG
GCACCCGTTCTCCATCACGTCGGCCCCACAC
GATGAGTACCTGAGCGTCCACATCAAGAACCTGGGCGACTGGACCGGCGCGCTCCAGAACGTA
TTCCCCGAGGTGAGGATTGACGGCCCGTACGTCGCGCCGGCGCAGGACTACAAACAA
TACAACGTCGTGCTTCTGGTAGGGCAGGGCATTGGCGTCACGCCCATGATCTCCATCATCAGAGACATCAGCAATAATATGAAGCAGTTGGACGACGACCTAGAGGCCGGCGCGGGCTTA
GGA
TCCTTCCACACGCAGCGGGCCTACTTCTACTGGGTGACCCCGGAGCAGGGCTCCTTCGAGTGGTTCCACGACGTCATGAACGAGGTGGCCGAGACCGACAAGAATGGCGTGATCGAG
CTCCACAACCACTGCACCAGCGTGTACGAGGAAGGGGACGCCCGCTCCGCACTCATCTCCATGATCCAGTCGTTCAACTACGCCAAGCACGGCGTCGACGTCGTGTCCGGCACCCGCGTC
AAGACCCACTTCGGCAGGCCCAACTGGCGCAACGTGTACGAGGAAATCGCGGAGAACCACCAAAACCAGTGCGTCG
GAGTGTTCTACTGTGGCGGTGCCCGGACCTTGCTAAAGACGCTG
CGCGAACTCACGCAGGAATTCTCACGGTCACGGACGACAGGGACAACCAAGTTCGAGTTCCATAAGGAGAACTTCTAG

Retrieve as FASTA