Entry information : CgraCIIAA01
Entry ID 8471
Creation 2011-08-24 (Christophe Dunand)
Last sequence changes 2012-11-06 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-11-06 (Christophe Dunand)
Peroxidase information: CgraCIIAA01
Name CgraCIIAA01
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Glomerella
Organism Colletotrichum graminicola (Glomerella graminicola)    [TaxId: 31870 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CgraCIIAA01
start..stop
S start..stop
CfioCIIAA01_PJ7 752 0 1..411 1..411
CfioCIIAA01_MH18 751 0 1..409 1..409
ChigCIIAA01 741 0 1..409 1..410
CgloCIIAA03_ST23 715 0 1..411 1..409
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1143494..1144072 579 N° 2 1142975..1143391 417 N° 3 1142681..1142920 240  
complement(join(1142681..1142920,1142975..1143391,1143494..1144072))


exon

Literature and cross-references CgraCIIAA01
DNA ref. GenBank:   GG697331.1 (1144072..1142681)
Protein sequence: CgraCIIAA01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   411 (390)
PWM (Da):   %s   44396.39 (42372.4)  
PI (pH):   %s   8.11 (8.10) Peptide Signal:   %s   cut: 22 range:22-411
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHITSLLAASLAMASVPGAMAYPGMGEQMADIKARTSNSGESTELLGDLVTLKDRDLTNVGKDVKRLLQGKGNPQSDDRYSSVPNLTSDKCKKDTCCVWRYVADDMYKFMAGSSGRCTSLARGAVRLGFHDAGTWSKATAGQGGGADGSILLAAGEIDRFENRGLQEVAAKFNELYGKYKGMGWDIGMGDFIQMGANVATVVCPLGPRIKTYVGRKDSSTPAPTGLLPSPFQPADQLIQLFRDKTISPHGLVALLGAHTTSQQQFVNTSRAGDPQDSTPGVWDVLYYKETLSPNSPPRVFKFPSDIFLSQHPETSKEFRDFAGIGGQQHWNEDYAREYIRLSLLGVNNINQLVECTKVLPPAVRGFRIIDQFKLDKWLNSVGNKGAAKKVADDIAKGDPASVEVPPVNNKN

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns). No EST available.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATATCACATCCCTCCTCGCCGCCTCCCTGGCCATGGCCTCCGTCCCGGGCGCCATGGCCTACCCCGGCATGGGCGAGCAGATGGCCGATATCAAAGCCCGTACGAGCAACTCGGGC
GAGTCCACCGAGCTCCTCGGCGACCTCGTCACCCTCAAGGACCGCGACCTCACCAACGTCGGCAAGGACGTCAAGCGGCTCCTCCAGGGCAAGGGCAACCCGCAGTCGGACGACCGGTAC
AGCAGCGTGCCCAACCTGACGTCGGACAAGTGCAAGAAGGACACGTGCTGCGTCTGGCGGTACGTCGCCGACGACATGTACAAGTTCATGGCGGGCTCGTCGGGCCGCTGCACGAGCCTG
GCGCGCGGCGCCGTCCGTCTCGGCTTCCACGACGCCGGGACCTGGTCCAAGGCCACGGCCGGCCAGGGCGGCGGCGCCGACGGCAGCATCCTGCTGGCCGCGGGCGAGATCGACCGCTTC
GAGAACCGCGGCCTCCAGGAGGTCGCCGCCAAGTTCAATGAGCTGTACGGCAAGTACAAGGGCATGGGCTGGGACATAGGCATGGGCGACTTCATCCAG
GTACGTTGCGGGGGACAATGA
CGACGACGACAACATGACAGGAAACAGGCGTCGGGCATGCTGACGAGAAATTAGATGGGCGCCAACGTCGCCACCGTCGTCTGCCCCCTCGGCCCGCGCATCAAGACCTACGTCGGGCGC
AAGGACAGCTCCACGCCGGCGCCGACCGGCCTCCTCCCCAGCCCGTTCCAGCCGGCCGACCAGCTGATCCAGCTCTTCCGCGACAAGACCATCTCCCCCCACGGCCTCGTGGCGCTGCTC
GGCGCGCACACCACCAGCCAGCAGCAGTTCGTCAACACGTCCCGCGCCGGCGACCCCCAGGACAGCACCCCGGGCGTGTGGGACGTCCTGTACTACAAGGAGACGCTCAGCCCCAACTCG
CCTCCCCGCGTGTTCAAGTTCCCCAGCGACATCTTCCTCTCGCAGCACCCCGAGACCTCCAAGGAGTTCAGGGACTTTGCCGGGATCGGCGGCCAGCAGCACTGGAACGAGGCAAGCTTC
CCCCCTTCTCCCCCGGAT
GTCCCAACTGGCGACGATTGCCTCAGCAAGTACTAACATGGAAAAACCCTGCAGGACTACGCCCGTGAATACATCCGCCTCTCGCTCCTGGGCGTCAACAAC
ATCAACCAGCTGGTCGAGTGCACCAAAGTGCTCCCCCCCGCGGTGAGGGGCTTCCGCATCATCGACCAGTTCAAGCTCGACAAGTGGCTCAACAGCGTCGGCAACAAGGGCGCCGCCAAG
AAGGTCGCCGACGACATCGCCAAGGGCGACCCGGCCTCCGTCGAGGTGCCCCCCGTCAACAACAAGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATATCACATCCCTCCTCGCCGCCTCCCTGGCCATGGCCTCCGTCCCGGGCGCCATGGCCTACCCCGGCATGGGCGAGCAGATGGCCGATATCAAAGCCCGTACGAGCAACTCGGGC
GAGTCCACCGAGCTCCTCGGCGACCTCGTCACCCTCAAGGACCGCGACCTCACCAACGTCGGCAAGGACGTCAAGCGGCTCCTCCAGGGCAAGGGCAACCCGCAGTCGGACGACCGGTAC
AGCAGCGTGCCCAACCTGACGTCGGACAAGTGCAAGAAGGACACGTGCTGCGTCTGGCGGTACGTCGCCGACGACATGTACAAGTTCATGGCGGGCTCGTCGGGCCGCTGCACGAGCCTG
GCGCGCGGCGCCGTCCGTCTCGGCTTCCACGACGCCGGGACCTGGTCCAAGGCCACGGCCGGCCAGGGCGGCGGCGCCGACGGCAGCATCCTGCTGGCCGCGGGCGAGATCGACCGCTTC
GAGAACCGCGGCCTCCAGGAGGTCGCCGCCAAGTTCAATGAGCTGTACGGCAAGTACAAGGGCATGGGCTGGGACATAGGCATGGGCGACTTCATCCAG
TGCCCCCTCGGCCCGCGCATC
AAGACCTACGTCGGGCGCAAGGACAGCTCCACGCCGGCGCCGACCGGCCTCCTCCCCAGCCCGTTCCAGCCGGCCGACCAGCTGATCCAGCTCTTCCGCGACAAGACCATCTCCCCCCAC
GGCCTCGTGGCGCTGCTCGGCGCGCACACCACCAGCCAGCAGCAGTTCGTCAACACGTCCCGCGCCGGCGACCCCCAGGACAGCACCCCGGGCGTGTGGGACGTCCTGTACTACAAGGAG
ACGCTCAGCCCCAACTCGCCTCCCCGCGTGTTCAAGTTCCCCAGCGACATCTTCCTCTCGCAGCACCCCGAGACCTCCAAGGAGTTCAGGGACTTTGCCGGGATCGGCGGCCAGCAGCAC
TGGAACGAGGCAAGCTTCCCCCCTTCTCCCCCGGAT
GACTACGCCCGTGAATACATCCGCCTCTCGCTCCTGGGCGTCAACAACATCAACCAGCTGGTCGAGTGCACCAAAGTGCTCCCC
CCCGCGGTGAGGGGCTTCCGCATCATCGACCAGTTCAAGCTCGACAAGTGGCTCAACAGCGTCGGCAACAAGGGCGCCGCCAAGAAGGTCGCCGACGACATCGCCAAGGGCGACCCGGCC
TCCGTCGAGGTGCCCCCCGTCAACAACAAGAACTAG

Retrieve as FASTA