Entry information : CgraCIIAA02
Entry ID 8472
Creation 2011-08-24 (Christophe Dunand)
Last sequence changes 2011-08-24 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-08-24 (Christophe Dunand)
Peroxidase information: CgraCIIAA02
Name CgraCIIAA02
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Glomerella
Organism Colletotrichum graminicola (Glomerella graminicola)    [TaxId: 31870 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CgraCIIAA02
start..stop
S start..stop
ChigCIIAA02 731 0 1..421 1..421
CfioCIIAA02_PJ7 715 0 1..421 1..422
CfioCIIAA02_MH18 715 0 1..421 1..422
CgloCIIAA02_ST23 710 0 1..421 1..423
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 203805..204424 620 N° 2 204490..205135 646  
join(203805..204424,204490..205135)


exon

Literature and cross-references CgraCIIAA02
DNA ref. GenBank:   GG697379.1 (203805..205135)
Protein sequence: CgraCIIAA02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   421 (404)
PWM (Da):   %s   44833.71 (43184.7)  
PI (pH):   %s   6.17 (5.81) Peptide Signal:   %s   cut: 18 range:18-421
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRVSVLAAALAATPILAYPGMKSTLSEIRSRADKDGNGADDGDSNELIGDLVTLDDSKFTTVGKSVKQLLTGSGTPESDEIYSISARGGNLAAKDSQACAADTCCIWKYIANDLQGVFKGASGRCTDLARAAVRLGFHDAGGWSKNTGPLGGADGSIILAPEEMTRGENRGLEEIVAQTKVWYNQYKKYGIGMADLVQFSANVATVVCPLGPRIRTYIGRKDSAAPCPNDLLPPVTGSADFLIQLFENKTIKAHGLTALIGAHTTSQQRFVDPNRAGDPQDSTPGVWDVKFYKETLGSAPARVFKFASDVVLAKDPRISAEFQAFAGPGGQSHWNEDYAREYIRLSLLGVDNINDLTECTKALPARTGSSFTAPDQAALDKWLATTDRVAKIADALRNGGNISSLINTVMGWLKGIFNFRW

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). No EST available.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGCGTGTCCGTTCTTGCCGCCGCTCTCGCGGCTACTCCTATCCTCGCCTACCCTGGCATGAAGAGCACCCTGTCAGAGATCCGTTCCCGTGCGGACAAGGACGGGAATGGCGCTGAC
GATGGCGACTCCAACGAGCTCATCGGCGACCTCGTCACCCTCGACGACTCAAAGTTCACCACTGTTGGCAAGAGCGTCAAGCAACTCCTCACCGGCTCCGGCACACCTGAGAGCGACGAG
ATCTACTCTATCTCCGCACGCGGCGGGAACCTCGCAGCCAAGGACTCCCAAGCTTGCGCTGCTGACACGTGCTGCATCTGGAAATACATCGCCAACGACCTCCAGGGCGTCTTTAAGGGG
GCTTCTGGCCGTTGTACGGACCTTGCTCGCGCTGCTGTTCGTCTGGGATTCCACGATGCTGGCGGTTGGTCCAAGAACACTGGTCCCCTTGGTGGCGCCGACGGCTCTATTATCCTCGCC
CCCGAAGAAATGACTCGTGGAGAGAACAGAGGTCTTGAAGAGATTGTCGCGCAGACCAAGGTTTGGTACAACCAGTACAAGAAGTACGGCATCGGTATGGCCGACCTCGTTCAGTTCTCC
GCCAACGTGGCCACCGTTGT
GTAAGTCTTCCGACGGTCTGCATGTAACATACATGTATCATGTATCGTCTGCTAACAACTAGAAGATGCCCTCTTGGACCTCGTATCCGCACCTACATCG
GCCGTAAAGACTCTGCTGCACCCTGCCCTAACGACCTCCTTCCTCCCGTCACCGGGTCTGCCGATTTCTTGATCCAGCTTTTCGAGAACAAGACCATTAAGGCTCACGGTCTGACTGCTC
TCATTGGCGCTCACACCACGAGCCAGCAGCGTTTCGTCGACCCCAACCGCGCCGGCGACCCTCAGGACAGCACTCCCGGTGTCTGGGACGTTAAGTTTTATAAGGAGACCCTCGGCTCTG
CCCCCGCCCGTGTCTTCAAGTTCGCCAGCGACGTGGTGCTGGCCAAGGACCCTCGCATCAGCGCCGAGTTCCAGGCCTTTGCAGGCCCGGGCGGACAGTCCCACTGGAACGAGGACTACG
CCCGCGAGTATATCCGCCTTTCTCTCCTCGGCGTGGATAACATCAACGACCTGACGGAGTGCACCAAGGCTCTTCCCGCTCGCACTGGCAGCAGTTTCACTGCTCCTGACCAGGCTGCCC
TTGACAAGTGGCTTGCCACCACCGACCGTGTTGCTAAGATTGCCGATGCGCTCCGAAACGGTGGCAACATTTCCAGTCTCATCAACACTGTGATGGGGTGGCTGAAGGGAATCTTCAATT
TCCGGTGGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGCGTGTCCGTTCTTGCCGCCGCTCTCGCGGCTACTCCTATCCTCGCCTACCCTGGCATGAAGAGCACCCTGTCAGAGATCCGTTCCCGTGCGGACAAGGACGGGAATGGCGCTGAC
GATGGCGACTCCAACGAGCTCATCGGCGACCTCGTCACCCTCGACGACTCAAAGTTCACCACTGTTGGCAAGAGCGTCAAGCAACTCCTCACCGGCTCCGGCACACCTGAGAGCGACGAG
ATCTACTCTATCTCCGCACGCGGCGGGAACCTCGCAGCCAAGGACTCCCAAGCTTGCGCTGCTGACACGTGCTGCATCTGGAAATACATCGCCAACGACCTCCAGGGCGTCTTTAAGGGG
GCTTCTGGCCGTTGTACGGACCTTGCTCGCGCTGCTGTTCGTCTGGGATTCCACGATGCTGGCGGTTGGTCCAAGAACACTGGTCCCCTTGGTGGCGCCGACGGCTCTATTATCCTCGCC
CCCGAAGAAATGACTCGTGGAGAGAACAGAGGTCTTGAAGAGATTGTCGCGCAGACCAAGGTTTGGTACAACCAGTACAAGAAGTACGGCATCGGTATGGCCGACCTCGTTCAGTTCTCC
GCCAACGTGGCCACCGTTGT
ATGCCCTCTTGGACCTCGTATCCGCACCTACATCGGCCGTAAAGACTCTGCTGCACCCTGCCCTAACGACCTCCTTCCTCCCGTCACCGGGTCTGCCGAT
TTCTTGATCCAGCTTTTCGAGAACAAGACCATTAAGGCTCACGGTCTGACTGCTCTCATTGGCGCTCACACCACGAGCCAGCAGCGTTTCGTCGACCCCAACCGCGCCGGCGACCCTCAG
GACAGCACTCCCGGTGTCTGGGACGTTAAGTTTTATAAGGAGACCCTCGGCTCTGCCCCCGCCCGTGTCTTCAAGTTCGCCAGCGACGTGGTGCTGGCCAAGGACCCTCGCATCAGCGCC
GAGTTCCAGGCCTTTGCAGGCCCGGGCGGACAGTCCCACTGGAACGAGGACTACGCCCGCGAGTATATCCGCCTTTCTCTCCTCGGCGTGGATAACATCAACGACCTGACGGAGTGCACC
AAGGCTCTTCCCGCTCGCACTGGCAGCAGTTTCACTGCTCCTGACCAGGCTGCCCTTGACAAGTGGCTTGCCACCACCGACCGTGTTGCTAAGATTGCCGATGCGCTCCGAAACGGTGGC
AACATTTCCAGTCTCATCAACACTGTGATGGGGTGGCTGAAGGGAATCTTCAATTTCCGGTGGTAG

Retrieve as FASTA