Entry information : CgraCIIAA04
Entry ID 8474
Creation 2011-08-24 (Christophe Dunand)
Last sequence changes 2011-08-24 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-08-25 (Christophe Dunand)
Peroxidase information: CgraCIIAA04
Name CgraCIIAA04
Class Asco Class II type A    [Orthogroup: CIIAA002]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Glomerella
Organism Colletotrichum graminicola (Glomerella graminicola)    [TaxId: 31870 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CgraCIIAA04
start..stop
S start..stop
ChigCIIAA04 566 0 1..368 1..413
CfioCIIAA04_PJ7 539 0 5..368 4..360
CfioCIIAA04_MH18 536 0 5..368 4..360
CgloCIIAA05_Naragc5 428 6e-151 58..367 40..350
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 214774..215790 1017 N° 2 214629..214721 93  
complement(join(214629..214721,214774..215790))


exon

Literature and cross-references CgraCIIAA04
DNA ref. GenBank:   GG697375.1 (215790..214629)
Protein sequence: CgraCIIAA04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   369 (349)
PWM (Da):   %s   38911.63 (36863.4) Transmb domain:   %s   i7-24o
PI (pH):   %s   4.87 (4.70) Peptide Signal:   %s   cut: 21 range:21-369
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPRSNKAVVLLTALTAIVVAYPGMGRVPDGVTHEDLISMLGRGGPNGGKYSARADDKEAIGDLLNISDNDLSDVGKDVKGILTADGSAVSSDSVDAVPDLGSNDCAADKCCVWKHVANDLITTFRDENGCTEPARASIRLGFHDAAGWSKNTGDLGGADGSIVLAPEEIGRSLNRGLEDIVEQMKVWHDKYSKFGAGMADLIQFAATTATVACPGGPRIKTFVGRKDSSVACPDGLLPDPRDNADKLIGLFANKTITPPGLVALVGAHTVSRQRFFDVARANAPQDTTPATWDVLFYQQTLAAAPSEIVTFPSDTVLSKDPRSAPAFKTFAEQAPLWGAAYAREYLRLSLLGVFNINELTDCTKALPSA*

Retrieve as FASTA  
Remarks Complete sequence from genomic. No EST available.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTCGTTCGAATAAAGCAGTTGTCCTTCTGACAGCACTCACTGCCATTGTCGTTGCTTACCCTGGCATGGGCCGGGTTCCCGACGGCGTGACCCATGAGGACCTGATATCAATGTTG
GGCCGCGGCGGACCCAATGGAGGCAAATACAGCGCCCGGGCCGATGACAAGGAAGCCATAGGCGACCTGCTCAATATTTCTGACAACGACCTTTCCGATGTCGGAAAAGACGTGAAGGGC
ATATTGACTGCCGATGGCAGCGCCGTCTCTTCGGACTCTGTAGATGCCGTCCCCGACCTTGGCAGCAACGACTGCGCCGCGGATAAGTGCTGCGTATGGAAGCACGTCGCCAACGACCTT
ATTACCACATTCCGCGACGAAAATGGTTGCACTGAACCTGCCCGCGCGTCCATCCGCCTGGGCTTCCACGATGCCGCCGGGTGGAGCAAAAATACCGGCGACCTCGGTGGCGCTGACGGG
TCCATCGTCCTCGCACCCGAGGAGATTGGGCGGTCCCTCAACAGAGGCCTAGAGGACATCGTGGAACAGATGAAGGTCTGGCACGATAAGTACAGCAAATTTGGCGCTGGCATGGCGGAC
CTGATCCAATTCGCTGCGACGACGGCCACCGTGGCGTGCCCCGGCGGGCCCAGGATCAAGACGTTCGTCGGCCGCAAGGACTCATCTGTGGCCTGTCCCGACGGCCTGTTGCCCGACCCA
AGGGACAACGCGGACAAGCTGATTGGTTTATTTGCGAATAAGACCATCACCCCTCCCGGCCTCGTCGCTCTCGTCGGCGCACACACTGTCAGTCGCCAACGGTTCTTTGATGTGGCACGC
GCCAACGCCCCTCAGGACACAACACCTGCAACCTGGGATGTCCTCTTCTACCAGCAAACTCTGGCTGCAGCTCCTTCGGAAATCGTGACCTTCCCTAGCGACACGGTCCTGTCGAAAGAC
CCAAGGTCTGCCCCGGCTTTCAAGACTTTTGCAGAGCAGGCACCGCTGTGGGGTGCT
GTAAGTCGCCACTTGAGTGTTATTCCGATGAACATAGCTAACCTGCGCACAGGCTTACGCGAG
AGAATACCTTCGTCTCAGCCTTCTTGGAGTCTTCAACATAAACGAGTTGACAGACTGTACGAAAGCGCTCCCGAGTGCCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTCGTTCGAATAAAGCAGTTGTCCTTCTGACAGCACTCACTGCCATTGTCGTTGCTTACCCTGGCATGGGCCGGGTTCCCGACGGCGTGACCCATGAGGACCTGATATCAATGTTG
GGCCGCGGCGGACCCAATGGAGGCAAATACAGCGCCCGGGCCGATGACAAGGAAGCCATAGGCGACCTGCTCAATATTTCTGACAACGACCTTTCCGATGTCGGAAAAGACGTGAAGGGC
ATATTGACTGCCGATGGCAGCGCCGTCTCTTCGGACTCTGTAGATGCCGTCCCCGACCTTGGCAGCAACGACTGCGCCGCGGATAAGTGCTGCGTATGGAAGCACGTCGCCAACGACCTT
ATTACCACATTCCGCGACGAAAATGGTTGCACTGAACCTGCCCGCGCGTCCATCCGCCTGGGCTTCCACGATGCCGCCGGGTGGAGCAAAAATACCGGCGACCTCGGTGGCGCTGACGGG
TCCATCGTCCTCGCACCCGAGGAGATTGGGCGGTCCCTCAACAGAGGCCTAGAGGACATCGTGGAACAGATGAAGGTCTGGCACGATAAGTACAGCAAATTTGGCGCTGGCATGGCGGAC
CTGATCCAATTCGCTGCGACGACGGCCACCGTGGCGTGCCCCGGCGGGCCCAGGATCAAGACGTTCGTCGGCCGCAAGGACTCATCTGTGGCCTGTCCCGACGGCCTGTTGCCCGACCCA
AGGGACAACGCGGACAAGCTGATTGGTTTATTTGCGAATAAGACCATCACCCCTCCCGGCCTCGTCGCTCTCGTCGGCGCACACACTGTCAGTCGCCAACGGTTCTTTGATGTGGCACGC
GCCAACGCCCCTCAGGACACAACACCTGCAACCTGGGATGTCCTCTTCTACCAGCAAACTCTGGCTGCAGCTCCTTCGGAAATCGTGACCTTCCCTAGCGACACGGTCCTGTCGAAAGAC
CCAAGGTCTGCCCCGGCTTTCAAGACTTTTGCAGAGCAGGCACCGCTGTGGGGTGCT
GCTTACGCGAGAGAATACCTTCGTCTCAGCCTTCTTGGAGTCTTCAACATAAACGAGTTGACA
GACTGTACGAAAGCGCTCCCGAGTGCCTAG

Retrieve as FASTA