Entry information : CgraCIIAC05
Entry ID 8475
Creation 2011-08-24 (Christophe Dunand)
Last sequence changes 2011-08-24 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-08-24 (Christophe Dunand)
Peroxidase information: CgraCIIAC05
Name CgraCIIAC05
Class Asco Class II type C    [Orthogroup: CIIAC001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Glomerella
Organism Colletotrichum graminicola (Glomerella graminicola)    [TaxId: 31870 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CgraCIIAC05
start..stop
S start..stop
ChigCIIAC05 423 2e-150 34..312 44..319
CfioCIIAC01_MH18 349 4e-121 25..312 23..310
CfioCIIAC_PJ7 343 5e-119 25..312 23..310
GgrCIIAC01 330 6e-114 1..309 1..308
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1299219..1299642 424 N° 2 1299766..1300009 244 N° 3 1300118..1300312 195 N° 4 1300385..1300460 76
join(1299219..1299642,1299766..1300009,1300118..1300312,1300385..1300460)


exon

Literature and cross-references CgraCIIAC05
DNA ref. GenBank:   GG697332.1 (1299219..1300460)
Protein sequence: CgraCIIAC05
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   312 (292)
PWM (Da):   %s   31966.61 (30100.5)  
PI (pH):   %s   4.37 (4.31) Peptide Signal:   %s   cut: 21 range:21-312
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRATTLVLAGLLAATAAAVALPGSSEDASSSSVRGLEARGPECPEVWAQVNAELNGLFLDDGGRCTALARGAIRALFHDCGTWDESQGQSGGCDGSLLIAADPDVELDRIENRGLPAVAGTLRDLAAKYNTTAADMVVFAGNAAIFLCPGGPKVTTYIGRADSTKSAKAGGLPSPFDPPETLLGLFKAKGLDAEALAALLGAHSTSTQSFVNASQAGAPQDSTPGEMDVAYYKQTHDFATSGAGAAPAGIFVFPSDAGVATSEADSVGRWFQSFIGEQEKWSESFKKSMDRMSLFGNDKSSMSDCTGSIAKL

Retrieve as FASTA  
Remarks Complete sequence from genomic. No EST available.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGCGCCACAACCCTCGTACTCGCCGGCCTCTTGGCCGCCACAGCCGCCGCCGTCGCACTGCCCGGGTCGTCAGAGGACGCTTCGTCTTCCTCGGTCCGCGGCCTCGAGGCGCGAGGC
CCTGAATGTCCGGAGGTCTGGGCGCAGGTCAACGCCGAGCTCAACGGGCTCTTCCTCGACGACGGCGGCCGGTGCACCGCCCTCGCCCGGGGCGCCATCCGCGCCCTCTTCCACGACTGC
GGCACCTGGGACGAGTCCCAAGGGCAGTCCGGCGGCTGCGACGGCTCGCTCCTCATCGCCGCCGATCCGGACGTCGAGCTCGACCGGATCGAGAACAGGGGTCTGCCGGCCGTCGCGGGC
ACGCTGAGGGACTTGGCCGCGAAGTATAACACGACTGCGGCGGATATGGTTGTCTTTGCCGGGA
GTGAGTTTTTTTGACATCTTTTTCTTTTTCTTCCCTCAAGTTCCTTTAGTGGTCTG
GCCAACGGCTTTTTGAGGTTCTGTAATGGACTGAGTGACTAACATATTCTGTCCGTCTTTTCTTCAGACGCTGCCATTTTCCTGTGTCCCGGCGGGCCGAAAGTCACGACCTACATCGGC
CGCGCGGATAGCACCAAGTCGGCCAAAGCCGGAGGGCTACCCAGCCCCTTTGACCCCCCCGAGACCCTCCTGGGCCTGTTCAAGGCCAAGGGGCTCGACGCCGAGGCCCTCGCCGCGCTG
CTCGGCGCCCACAGCACCTCGACGCAGTCCTTCGTCAACGCCTCGCAGGCGGGGGCGCCGCAGGACTCTAC
GTAAGTTGGCCCAAAACCTTGATTTCCTCGGTCGCGGTGAAGGGGATGG
AGGGGCAGTGGTGCGAAGACCCGCCGGCAAGGTTGTTTCGCTAACGTTTGTAAACGCAGGCCGGGAGAGATGGACGTGGCCTACTACAAGCAGACGCACGACTTTGCCACCTCCGGAGCC
GGCGCCGCCCCGGCCGGCATTTTTGTGTTCCCGTCGGACGCGGGCGTCGCGACCTCGGAGGCCGACAGCGTCGGCCGCTGGTTCCAGAGCTTCATCGGGGAGCAGGAGAAGTGGAGCGAG
AGCTTCAAGAAGTC
GTAAGTGGGAAGCCCGTCGTCGGGTCCCGTTCCGACGTGCGTTGCGAGCGTCCAGCGCTGACCACAGAATAGGATGGACAGGATGTCTCTATTCGGCAACGATAAG
AGCAGCATGTCGGACTGCACCGGCTCCATAGCCAAGCTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGCGCCACAACCCTCGTACTCGCCGGCCTCTTGGCCGCCACAGCCGCCGCCGTCGCACTGCCCGGGTCGTCAGAGGACGCTTCGTCTTCCTCGGTCCGCGGCCTCGAGGCGCGAGGC
CCTGAATGTCCGGAGGTCTGGGCGCAGGTCAACGCCGAGCTCAACGGGCTCTTCCTCGACGACGGCGGCCGGTGCACCGCCCTCGCCCGGGGCGCCATCCGCGCCCTCTTCCACGACTGC
GGCACCTGGGACGAGTCCCAAGGGCAGTCCGGCGGCTGCGACGGCTCGCTCCTCATCGCCGCCGATCCGGACGTCGAGCTCGACCGGATCGAGAACAGGGGTCTGCCGGCCGTCGCGGGC
ACGCTGAGGGACTTGGCCGCGAAGTATAACACGACTGCGGCGGATATGGTTGTCTTTGCCGGGA
ACGCTGCCATTTTCCTGTGTCCCGGCGGGCCGAAAGTCACGACCTACATCGGCCGC
GCGGATAGCACCAAGTCGGCCAAAGCCGGAGGGCTACCCAGCCCCTTTGACCCCCCCGAGACCCTCCTGGGCCTGTTCAAGGCCAAGGGGCTCGACGCCGAGGCCCTCGCCGCGCTGCTC
GGCGCCCACAGCACCTCGACGCAGTCCTTCGTCAACGCCTCGCAGGCGGGGGCGCCGCAGGACTCTAC
GCCGGGAGAGATGGACGTGGCCTACTACAAGCAGACGCACGACTTTGCCACC
TCCGGAGCCGGCGCCGCCCCGGCCGGCATTTTTGTGTTCCCGTCGGACGCGGGCGTCGCGACCTCGGAGGCCGACAGCGTCGGCCGCTGGTTCCAGAGCTTCATCGGGGAGCAGGAGAAG
TGGAGCGAGAGCTTCAAGAAGTC
GATGGACAGGATGTCTCTATTCGGCAACGATAAGAGCAGCATGTCGGACTGCACCGGCTCCATAGCCAAGCTTTGA

Retrieve as FASTA