Entry information : ChigCIIAA01
Entry ID 8483
Creation 2011-08-25 (Christophe Dunand)
Last sequence changes 2011-08-25 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-08-25 (Christophe Dunand)
Peroxidase information: ChigCIIAA01
Name ChigCIIAA01
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Colletotrichum
Organism Colletotrichum higginsianum    [TaxId: 80884 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ChigCIIAA01
start..stop
S start..stop
CfioCIIAA01_MH18 759 0 1..410 1..409
CfioCIIAA01_PJ7 758 0 1..410 1..409
CgraCIIAA01 741 0 1..410 1..409
CgloCIIAA03_ST23 722 0 1..410 1..407
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1641..2222 582 N° 2 2303..2719 417 N° 3 2805..3038 234  
join(1641..2222,2303..2719,2805..3038)


exon

Literature and cross-references ChigCIIAA01
DNA ref. Broad_Colleto:   S7000006585829706
Protein sequence: ChigCIIAA01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   411 (389)
PWM (Da):   %s   44538.69 (42386.6)  
PI (pH):   %s   7.83 (7.81) Peptide Signal:   %s   cut: 22 range:22-410
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHLTSLLATSMALAAVPGAMAYPGMGQQIEDIKARASDRGDSNELLGDLISLQDRQLTAVGKDVKRILQGKGDPESNDRYILKVPDLTSDKCKKDTCCVWRYVADDMYQFMAGKSGRCTGLARAAVRLGFHDAGTWSKATASQGGGADGSILLAPGEIDRFENRGLQEVAAKFIELRGKYLSMGWNIGMGDFIQMGANVATVVCPLGPRIKTYVGRKDSAVGAPRGLLPSPFQPADQLIQLFRDKTIGPHGLVALLGAHTTSQQNFVNTTRAGDPQDSTPGVWDVLYYKETLSTNSPPRVFKFPSDIAISQHPETAKEFQDFAGRGGQDHWNEDYAREYIRLSLLGVDNINQLVECTKVLPPAIKGFRILDQFKLDKWLNSVGNKGAAKKVAQDIEKGDPASVEVPPVNN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCTCACCTCTCTCCTCGCCACCTCCATGGCCCTGGCCGCCGTCCCCGGGGCCATGGCCTACCCCGGCATGGGCCAGCAGATTGAAGATATCAAGGCCCGCGCGAGCGATAGGGGC
GACTCGAACGAGCTCCTCGGAGACCTCATCTCCCTCCAGGACCGCCAGCTCACCGCCGTCGGCAAAGACGTCAAGAGGATCCTCCAGGGCAAGGGGGACCCGGAGTCTAACGACCGCTAC
ATCCTCAAGGTGCCTGACTTGACCTCGGACAAGTGCAAGAAGGACACGTGCTGCGTCTGGCGCTACGTCGCCGACGACATGTACCAGTTCATGGCAGGCAAGTCAGGCCGTTGCACTGGC
CTGGCGCGCGCCGCCGTGCGCCTCGGCTTCCACGACGCCGGCACTTGGTCCAAGGCCACGGCCTCCCAGGGCGGCGGCGCCGACGGCAGCATTCTGCTCGCACCGGGCGAGATCGACCGC
TTCGAGAACCGCGGCCTGCAGGAGGTCGCCGCCAAGTTCATCGAGCTCCGCGGCAAGTACCTTTCTATGGGTTGGAACATCGGCATGGGTGACTTTATCCAG
GTATGTTACGGGACGGCC
TTGTTGTCATATTACGTGCGCAACACTTCATCTTTTTCGTCGTGCTCACATATCTGGTTCAGATGGGTGCCAACGTCGCCACCGTCGTCTGCCCCCTCGGCCCGCGCATCAAGACCTACG
TCGGCCGTAAGGACAGCGCCGTGGGGGCGCCCCGCGGTCTCTTGCCGAGCCCGTTCCAGCCGGCCGACCAGCTGATCCAGCTCTTCCGCGACAAGACCATCGGCCCGCATGGCCTCGTCG
CCCTGCTCGGCGCACACACGACCAGCCAGCAGAACTTTGTCAACACGACGCGCGCCGGCGACCCCCAGGATAGCACCCCGGGCGTTTGGGACGTGCTCTACTACAAGGAGACGCTCAGCA
CCAACTCCCCCCCCAGAGTTTTCAAGTTCCCCAGCGACATCGCCATCTCGCAGCACCCGGAGACTGCCAAGGAGTTCCAAGACTTTGCCGGACGCGGCGGCCAGGACCACTGGAACGAG
G
TAAGCCCTCCCCCCCCTCTTCTCTCGACGCTGAGTTTAGACCAATTCGCTTGTTGCAAAAAGTACTGACGATGAATCCCGACAGGACTACGCCCGTGAGTACATCCGCCTCTCGCTGTTG
GGCGTCGACAACATCAACCAGCTGGTCGAGTGCACCAAGGTCCTCCCGCCGGCGATCAAGGGTTTCCGCATCCTCGACCAGTTCAAGCTCGACAAGTGGCTCAACAGCGTCGGCAACAAG
GGTGCCGCCAAGAAGGTCGCCCAGGATATTGAGAAGGGCGACCCCGCCTCCGTCGAGGTGCCCCCCGTCAACAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCTCACCTCTCTCCTCGCCACCTCCATGGCCCTGGCCGCCGTCCCCGGGGCCATGGCCTACCCCGGCATGGGCCAGCAGATTGAAGATATCAAGGCCCGCGCGAGCGATAGGGGC
GACTCGAACGAGCTCCTCGGAGACCTCATCTCCCTCCAGGACCGCCAGCTCACCGCCGTCGGCAAAGACGTCAAGAGGATCCTCCAGGGCAAGGGGGACCCGGAGTCTAACGACCGCTAC
ATCCTCAAGGTGCCTGACTTGACCTCGGACAAGTGCAAGAAGGACACGTGCTGCGTCTGGCGCTACGTCGCCGACGACATGTACCAGTTCATGGCAGGCAAGTCAGGCCGTTGCACTGGC
CTGGCGCGCGCCGCCGTGCGCCTCGGCTTCCACGACGCCGGCACTTGGTCCAAGGCCACGGCCTCCCAGGGCGGCGGCGCCGACGGCAGCATTCTGCTCGCACCGGGCGAGATCGACCGC
TTCGAGAACCGCGGCCTGCAGGAGGTCGCCGCCAAGTTCATCGAGCTCCGCGGCAAGTACCTTTCTATGGGTTGGAACATCGGCATGGGTGACTTTATCCAG
ATGGGTGCCAACGTCGCC
ACCGTCGTCTGCCCCCTCGGCCCGCGCATCAAGACCTACGTCGGCCGTAAGGACAGCGCCGTGGGGGCGCCCCGCGGTCTCTTGCCGAGCCCGTTCCAGCCGGCCGACCAGCTGATCCAG
CTCTTCCGCGACAAGACCATCGGCCCGCATGGCCTCGTCGCCCTGCTCGGCGCACACACGACCAGCCAGCAGAACTTTGTCAACACGACGCGCGCCGGCGACCCCCAGGATAGCACCCCG
GGCGTTTGGGACGTGCTCTACTACAAGGAGACGCTCAGCACCAACTCCCCCCCCAGAGTTTTCAAGTTCCCCAGCGACATCGCCATCTCGCAGCACCCGGAGACTGCCAAGGAGTTCCAA
GACTTTGCCGGACGCGGCGGCCAGGACCACTGGAACGAG
GACTACGCCCGTGAGTACATCCGCCTCTCGCTGTTGGGCGTCGACAACATCAACCAGCTGGTCGAGTGCACCAAGGTCCTC
CCGCCGGCGATCAAGGGTTTCCGCATCCTCGACCAGTTCAAGCTCGACAAGTGGCTCAACAGCGTCGGCAACAAGGGTGCCGCCAAGAAGGTCGCCCAGGATATTGAGAAGGGCGACCCC
GCCTCCGTCGAGGTGCCCCCCGTCAACAACTAA

Retrieve as FASTA