Entry information : ChigCIIAA02
Entry ID 8484
Creation 2011-08-25 (Christophe Dunand)
Last sequence changes 2011-08-25 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-08-25 (Christophe Dunand)
Peroxidase information: ChigCIIAA02
Name ChigCIIAA02
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Colletotrichum
Organism Colletotrichum higginsianum    [TaxId: 80884 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ChigCIIAA02
start..stop
S start..stop
CgraCIIAA02 757 0 1..421 1..421
CfioCIIAA02_PJ7 733 0 1..421 1..422
CfioCIIAA02_MH18 733 0 1..421 1..422
CgloCIIAA02_ST23 716 0 1..421 1..423
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1329..1948 620 N° 2 619..1270 652  
complement(join(619..1270,1329..1948))


exon

Literature and cross-references ChigCIIAA02
DNA ref. Broad_Colleto:   S7000006585848056
Protein sequence: ChigCIIAA02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   423 (406)
PWM (Da):   %s   45294.83 (43615.9)  
PI (pH):   %s   6.9 (6.52) Peptide Signal:   %s   cut: 18 range:18-423
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRVSLLTAALAATPVLAYPGMKSTFSEIRSRADKDGNGADEGDSNELLGDLLTLDDSKLTPVGKSVKQLLTGFDKPESDEAYSTSARGGNLAAKGSAACAADTCCIWRYIANDLQATFRGKSGRCTDLARAAIRLGFHDAGGWSKSTGDLGGADGSIILSSDEMTRGENRGLEEIVAQTQVWYNQYKQYGIGMADLIQFSANAATVVCPLGPRVRTFVGRKDSSAPCPDNLLPPVTGSADFLIQLFENKTIKAHGLTALIGAHTTSQQRFVDPSRAGDPQDSSPGVWDVKFYKETLGSAPARVFKFASDVVLSRDPRISAEFKAFAGPGGQSHWNEDYAREYIRLSLLGVNNINDLTECTKALPSRSGSTFNAPDQAALDKWLATKDRVAKIADELRNGGNISNLITSVFGWLRGIFGLRFMF

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGCGTGTCCCTCCTTACCGCCGCCCTCGCGGCCACCCCCGTCCTCGCCTATCCCGGCATGAAAAGCACCTTCTCCGAGATCCGTTCCCGTGCAGACAAGGACGGCAACGGCGCCGAC
GAGGGCGACTCCAACGAGCTCCTCGGCGATCTCCTCACCCTCGACGACTCCAAGCTCACCCCGGTCGGGAAGAGCGTCAAGCAGCTCCTCACGGGCTTCGACAAGCCCGAGAGCGACGAG
GCCTATTCCACCTCTGCCCGCGGCGGGAACCTCGCCGCCAAGGGCTCCGCGGCCTGCGCTGCCGACACCTGCTGCATCTGGCGATACATTGCAAACGACTTGCAGGCCACCTTCCGGGGC
AAGTCAGGTCGTTGCACCGACCTTGCCCGTGCCGCCATCCGTCTGGGATTCCATGATGCCGGCGGTTGGTCCAAGAGCACCGGGGACCTTGGAGGCGCTGATGGCTCGATTATCCTGTCG
TCTGATGAGATGACTCGTGGAGAGAACAGAGGTCTTGAGGAGATTGTTGCGCAGACCCAGGTCTGGTACAACCAGTACAAGCAGTACGGCATCGGCATGGCCGATCTCATCCAGTTCTCC
GCCAACGCTGCCACCGTCGT
GTAAGTCCCTGAGGCTTGGTCTCTCGACGATTTGACCACGTACTAACGATTCTTGCAGTTGCCCTCTCGGACCTCGTGTACGCACCTTCGTGGGCCGCAA
GGACTCTTCCGCCCCTTGCCCTGACAACTTGCTTCCTCCCGTGACCGGCTCCGCCGATTTCTTGATCCAGCTCTTCGAGAACAAGACGATCAAGGCCCACGGCCTCACGGCCCTCATTGG
CGCCCATACCACCAGCCAGCAGCGGTTCGTCGACCCCAGCCGCGCCGGCGACCCGCAGGACAGCTCCCCGGGTGTCTGGGACGTCAAGTTCTACAAGGAGACCCTCGGATCCGCCCCGGC
TCGCGTCTTCAAGTTCGCCAGCGACGTCGTGCTCTCCAGAGACCCCCGCATCAGCGCCGAGTTCAAGGCCTTTGCCGGCCCGGGGGGACAGTCCCACTGGAACGAGGACTACGCCCGGGA
GTACATCCGCCTCTCCCTCCTCGGCGTCAACAACATCAACGACCTGACCGAGTGCACCAAGGCCCTGCCCTCCCGCTCCGGCAGCACCTTCAACGCCCCCGACCAGGCCGCCCTCGACAA
GTGGCTCGCCACCAAGGACCGCGTTGCCAAGATTGCCGACGAGCTGCGGAACGGCGGCAACATCAGCAATCTCATCACCTCCGTGTTCGGATGGCTCAGGGGCATCTTCGGTCTCAGGTT
CATGTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGCGTGTCCCTCCTTACCGCCGCCCTCGCGGCCACCCCCGTCCTCGCCTATCCCGGCATGAAAAGCACCTTCTCCGAGATCCGTTCCCGTGCAGACAAGGACGGCAACGGCGCCGAC
GAGGGCGACTCCAACGAGCTCCTCGGCGATCTCCTCACCCTCGACGACTCCAAGCTCACCCCGGTCGGGAAGAGCGTCAAGCAGCTCCTCACGGGCTTCGACAAGCCCGAGAGCGACGAG
GCCTATTCCACCTCTGCCCGCGGCGGGAACCTCGCCGCCAAGGGCTCCGCGGCCTGCGCTGCCGACACCTGCTGCATCTGGCGATACATTGCAAACGACTTGCAGGCCACCTTCCGGGGC
AAGTCAGGTCGTTGCACCGACCTTGCCCGTGCCGCCATCCGTCTGGGATTCCATGATGCCGGCGGTTGGTCCAAGAGCACCGGGGACCTTGGAGGCGCTGATGGCTCGATTATCCTGTCG
TCTGATGAGATGACTCGTGGAGAGAACAGAGGTCTTGAGGAGATTGTTGCGCAGACCCAGGTCTGGTACAACCAGTACAAGCAGTACGGCATCGGCATGGCCGATCTCATCCAGTTCTCC
GCCAACGCTGCCACCGTCGT
TTGCCCTCTCGGACCTCGTGTACGCACCTTCGTGGGCCGCAAGGACTCTTCCGCCCCTTGCCCTGACAACTTGCTTCCTCCCGTGACCGGCTCCGCCGAT
TTCTTGATCCAGCTCTTCGAGAACAAGACGATCAAGGCCCACGGCCTCACGGCCCTCATTGGCGCCCATACCACCAGCCAGCAGCGGTTCGTCGACCCCAGCCGCGCCGGCGACCCGCAG
GACAGCTCCCCGGGTGTCTGGGACGTCAAGTTCTACAAGGAGACCCTCGGATCCGCCCCGGCTCGCGTCTTCAAGTTCGCCAGCGACGTCGTGCTCTCCAGAGACCCCCGCATCAGCGCC
GAGTTCAAGGCCTTTGCCGGCCCGGGGGGACAGTCCCACTGGAACGAGGACTACGCCCGGGAGTACATCCGCCTCTCCCTCCTCGGCGTCAACAACATCAACGACCTGACCGAGTGCACC
AAGGCCCTGCCCTCCCGCTCCGGCAGCACCTTCAACGCCCCCGACCAGGCCGCCCTCGACAAGTGGCTCGCCACCAAGGACCGCGTTGCCAAGATTGCCGACGAGCTGCGGAACGGCGGC
AACATCAGCAATCTCATCACCTCCGTGTTCGGATGGCTCAGGGGCATCTTCGGTCTCAGGTTCATGTTCTAG

Retrieve as FASTA