Entry information : ChigCIIAA04
Entry ID 8489
Creation 2011-08-25 (Christophe Dunand)
Last sequence changes 2017-05-03 (Catherine Mathe)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-05-03 (Catherine Mathe)
Peroxidase information: ChigCIIAA04
Name ChigCIIAA04
Class Asco Class II type A    [Orthogroup: CIIAA002]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Colletotrichum
Organism Colletotrichum higginsianum    [TaxId: 80884 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ChigCIIAA04
start..stop
S start..stop
CgraCIIAA04 585 0 1..413 1..368
CfioCIIAA04_PJ7 547 0 6..419 5..366
CfioCIIAA04_MH18 545 0 6..419 5..366
CgloCIIAA05_ST23 418 3e-146 102..412 39..350
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5248445..5249596 1152 N° 2 5248263..5248373 111  
complement(join(5248263..5248373,5248445..5249596))


exon

Literature and cross-references ChigCIIAA04
DNA ref. JGI genome:   chromosome_3 (5249596..5248263)
Cluster/Prediction ref. JGI gene:   6325
Protein sequence: ChigCIIAA04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   420 (400)
PWM (Da):   %s   43651.55 (41680.5) Transmb domain:   %s   i7-29o (i7-29o)
PI (pH):   %s   5.11 (4.88) Peptide Signal:   %s   cut: 21 range:21-420
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPSGKAVVFLTALTAIAAAYPGMGRVPGGMTHEEMVAKITRDSRTGFNGGAVNGGFNGGPNRGPNGPNTGPNRGPNGSNVGPNNGFNNGFNNGFTTRAEDNEIIGDLMKVPDNDLSDVGKDVKGILTGNGNAVSDAAEGSVPDLGSAECSADKCCVWKHVADEIMPTFRDANGCTDPARASIRLGFHDAAGWSKGTGDLGGADGSIVLAPEEIGRPANDGLEDIVEQMKTWHAKFSEFGAGMADLIQFAATTATVACPGGPRIKTFVGRKDSSVAAPDGLLPDPRDNADKLIELFGNKTISAPGLAALVGAHTSSRQRFFDPSRANAPQDTTPAVWDVLFYQETLNASPGDIVTFPSDIALSKDPRSAPAFRAFAQQAPLWGAAYARQYLRLSLLGVFNINELTDCTKALPAGTAAKRS*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCTTCAGGTAAAGCAGTCGTCTTCCTTACGGCCTTGACAGCCATCGCAGCCGCATATCCCGGCATGGGCAGGGTCCCTGGCGGCATGACCCACGAGGAGATGGTGGCAAAGATC
ACCCGCGACAGCCGTACCGGCTTCAATGGCGGTGCCGTCAATGGCGGATTCAACGGCGGTCCCAATCGCGGTCCCAACGGCCCCAATACCGGACCCAACCGCGGCCCCAATGGCTCCAAC
GTCGGTCCCAACAACGGCTTTAACAACGGCTTCAACAACGGCTTCACCACTCGAGCCGAAGACAACGAGATCATTGGTGACCTCATGAAGGTGCCTGACAACGACCTCTCCGACGTCGGA
AAAGACGTCAAGGGCATCTTGACCGGCAACGGCAACGCCGTGTCAGACGCCGCCGAGGGCAGCGTCCCCGATCTCGGCAGCGCCGAGTGCAGCGCGGACAAGTGCTGCGTGTGGAAGCAC
GTCGCCGACGAGATCATGCCCACCTTCCGCGACGCCAACGGCTGCACCGACCCGGCCCGGGCCTCGATCCGCCTGGGCTTCCACGACGCCGCAGGGTGGAGCAAAGGCACCGGCGACCTC
GGCGGCGCCGACGGGTCCATCGTCCTCGCGCCAGAGGAGATCGGCCGTCCGGCCAACGACGGGCTCGAGGACATCGTCGAGCAGATGAAGACGTGGCACGCCAAGTTCAGCGAGTTCGGC
GCCGGCATGGCCGACCTGATCCAGTTCGCCGCCACCACCGCCACCGTCGCGTGTCCCGGCGGGCCGCGGATCAAGACCTTCGTCGGCCGCAAGGACTCCTCCGTCGCGGCGCCCGACGGC
CTGCTGCCGGATCCGAGGGACAACGCCGATAAGCTGATCGAGCTGTTCGGGAATAAGACCATCTCGGCCCCGGGGCTCGCGGCCCTCGTCGGCGCCCACACCTCCAGCCGCCAGCGCTTC
TTCGACCCGTCGCGCGCCAACGCGCCGCAGGACACGACGCCCGCCGTCTGGGACGTCCTCTTCTACCAGGAGACCCTGAACGCGAGCCCCGGAGACATCGTCACCTTCCCCAGCGACATC
GCCTTGTCCAAAGACCCACGGTCCGCCCCGGCGTTCCGGGCTTTTGCGCAGCAGGCGCCTCTCTGGGGTGCT
GTAAGTTTTCAACCGGGGATCCCCTGGAGTTTTCCCCCGTGGACGTTG
GCTGACTGGAGCGTTGCGTGTAGGCTTATGCGAGGCAATATCTCCGCCTCAGCTTGCTTGGGGTGTTCAACATCAACGAGCTGACCGATTGCACCAAGGCGCTGCCCGCCGGGACTGCTG
CCAAGAGGTCGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCTTCAGGTAAAGCAGTCGTCTTCCTTACGGCCTTGACAGCCATCGCAGCCGCATATCCCGGCATGGGCAGGGTCCCTGGCGGCATGACCCACGAGGAGATGGTGGCAAAGATC
ACCCGCGACAGCCGTACCGGCTTCAATGGCGGTGCCGTCAATGGCGGATTCAACGGCGGTCCCAATCGCGGTCCCAACGGCCCCAATACCGGACCCAACCGCGGCCCCAATGGCTCCAAC
GTCGGTCCCAACAACGGCTTTAACAACGGCTTCAACAACGGCTTCACCACTCGAGCCGAAGACAACGAGATCATTGGTGACCTCATGAAGGTGCCTGACAACGACCTCTCCGACGTCGGA
AAAGACGTCAAGGGCATCTTGACCGGCAACGGCAACGCCGTGTCAGACGCCGCCGAGGGCAGCGTCCCCGATCTCGGCAGCGCCGAGTGCAGCGCGGACAAGTGCTGCGTGTGGAAGCAC
GTCGCCGACGAGATCATGCCCACCTTCCGCGACGCCAACGGCTGCACCGACCCGGCCCGGGCCTCGATCCGCCTGGGCTTCCACGACGCCGCAGGGTGGAGCAAAGGCACCGGCGACCTC
GGCGGCGCCGACGGGTCCATCGTCCTCGCGCCAGAGGAGATCGGCCGTCCGGCCAACGACGGGCTCGAGGACATCGTCGAGCAGATGAAGACGTGGCACGCCAAGTTCAGCGAGTTCGGC
GCCGGCATGGCCGACCTGATCCAGTTCGCCGCCACCACCGCCACCGTCGCGTGTCCCGGCGGGCCGCGGATCAAGACCTTCGTCGGCCGCAAGGACTCCTCCGTCGCGGCGCCCGACGGC
CTGCTGCCGGATCCGAGGGACAACGCCGATAAGCTGATCGAGCTGTTCGGGAATAAGACCATCTCGGCCCCGGGGCTCGCGGCCCTCGTCGGCGCCCACACCTCCAGCCGCCAGCGCTTC
TTCGACCCGTCGCGCGCCAACGCGCCGCAGGACACGACGCCCGCCGTCTGGGACGTCCTCTTCTACCAGGAGACCCTGAACGCGAGCCCCGGAGACATCGTCACCTTCCCCAGCGACATC
GCCTTGTCCAAAGACCCACGGTCCGCCCCGGCGTTCCGGGCTTTTGCGCAGCAGGCGCCTCTCTGGGGTGCT
GCTTATGCGAGGCAATATCTCCGCCTCAGCTTGCTTGGGGTGTTCAAC
ATCAACGAGCTGACCGATTGCACCAAGGCGCTGCCCGCCGGGACTGCTGCCAAGAGGTCGTAA

Retrieve as FASTA