Entry information : GgrCcP
Entry ID 8492
Creation 2011-08-26 (Christophe Dunand)
Last sequence changes 2012-07-16 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-07-16 (Christophe Dunand)
Peroxidase information: GgrCcP
Name GgrCcP
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Magnaporthaceae Gaeumannomyces
Organism Gaeumannomyces graminis    [TaxId: 29850 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GgrCcP
start..stop
S start..stop
MpoaCcP02 579 0 72..362 1..291
MEspCcP02_NRRL54901 545 0 1..362 1..358
MgrCcP02 544 0 1..362 3..364
ManiCcP01 534 0 1..360 1..359
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 44146..44641 496 N° 2 43680..44053 374 N° 3 43371..43589 219  
complement(join(43371..43589,43680..44053,44146..44641))


exon

Literature and cross-references GgrCcP
DNA ref. GenBank:   ADBI01000784.1 (44641..43371)
Protein sequence: GgrCcP
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   363
PWM (Da):   %s   40139.13  
PI (pH):   %s   9.33
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASTSRQFLRAASRTTARGTFSTSARTAGRRFYSSEAPKAAPKAELPKPASGGSSWIWLAGGAAAVGGLGLWYTQQGPAKLTKPEFKDYQAVYDEVAKLLQEKDDYEDGSYGPILVRLAWHASGTYDKETGTGGSNGATMRFAPEGDHGANAGLKTARDFLEPVKAKFPWITHSDLWILSGVCAIQEMLGPKVPFRPGRSDKDMAACTPDGRLPDATQGADHLRNIFYRMGFNDQEIVALSGGHALGRCHTDRSGFDGPWTFSPTVLTNDFYKLLLEEKWDWKKWNGPKYVDKKTKTLMMLPTDMVLIQDKQFLPWVKKYAADSDLFFKDFSNVVLKLFELGVPFAQSSENQRWVFKSSSE*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCCACCTCCCGTCAGTTCCTCCGCGCCGCTAGCCGGACCACGGCTCGCGGCACCTTCTCCACCAGCGCCCGCACCGCCGGTCGCCGCTTCTACTCGTCCGAGGCCCCCAAGGCA
GCCCCCAAGGCAGAGCTCCCCAAGCCCGCGAGCGGCGGCTCCTCCTGGATCTGGCTGGCCGGTGGCGCCGCTGCCGTCGGCGGCCTGGGACTCTGGTACACCCAGCAGGGCCCCGCCAAG
CTCACCAAGCCCGAGTTCAAGGACTATCAGGCCGTCTATGACGAGGTCGCCAAGCTCCTGCAGGAGAAGGACGACTACGAGGACGGCAGCTACGGCCCCATCCTCGTCCGCCTCGCCTGG
CACGCCAGCGGCACCTACGACAAGGAGACCGGCACCGGCGGCAGCAACGGCGCCACCATGCGCTTCGCCCCCGAGGGCGACCACGGCGCCAACGCTGGCCTGAAGACGGCCCGGGACTTC
CTCGAGCCCGTCAAAG
GTATGTTGTTTTGCCCGCTCACATCCACAGAAGGGGAAGAAACAAAGAAGAAAAAAAGGCGCTGGCACATTGCTGACGCCCCCACCCAACAGCCAAGTTCCCCT
GGATCACGCACTCGGACCTGTGGATCCTGTCGGGCGTCTGCGCCATCCAGGAGATGCTGGGCCCCAAGGTCCCCTTCCGGCCCGGCCGCTCCGACAAGGACATGGCCGCCTGCACCCCCG
ACGGCCGCCTCCCCGACGCTACCCAGGGCGCCGACCACCTGAGGAACATCTTCTACCGCATGGGCTTCAACGACCAGGAGATTGTGGCCCTGTCGGGCGGCCACGCCCTCGGCCGCTGCC
ACACGGACCGCAGCGGCTTCGACGGCCCGTGGACCTTCTCGCCCACCGTCCTGACCAACGACTTCTACAAGCTGCTGCTCGAGGAGAAGTGGGACTGGAAGAAGTGGAACGGCCCCAAGC
AG
GTAAGAGAAAGGAGGCCTTGTGAGAGGACAGAAGAGAGAAAACAAAACGAGATTGCTGACACTTGCCACCTTTTTTCCCCCATCTTGCAGTACGTCGACAAGAAGACCAAGACCCTGA
TGATGCTGCCCACCGACATGGTGCTCATCCAGGACAAGCAGTTCCTGCCGTGGGTCAAGAAGTACGCTGCCGACAGCGACCTGTTCTTCAAGGACTTCTCCAACGTCGTCCTCAAGCTCT
TTGAGCTTGGCGTGCCTTTTGCCCAGAGCAGCGAGAACCAGAGGTGGGTCTTCAAGTCGAGCAGCGAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCCACCTCCCGTCAGTTCCTCCGCGCCGCTAGCCGGACCACGGCTCGCGGCACCTTCTCCACCAGCGCCCGCACCGCCGGTCGCCGCTTCTACTCGTCCGAGGCCCCCAAGGCA
GCCCCCAAGGCAGAGCTCCCCAAGCCCGCGAGCGGCGGCTCCTCCTGGATCTGGCTGGCCGGTGGCGCCGCTGCCGTCGGCGGCCTGGGACTCTGGTACACCCAGCAGGGCCCCGCCAAG
CTCACCAAGCCCGAGTTCAAGGACTATCAGGCCGTCTATGACGAGGTCGCCAAGCTCCTGCAGGAGAAGGACGACTACGAGGACGGCAGCTACGGCCCCATCCTCGTCCGCCTCGCCTGG
CACGCCAGCGGCACCTACGACAAGGAGACCGGCACCGGCGGCAGCAACGGCGCCACCATGCGCTTCGCCCCCGAGGGCGACCACGGCGCCAACGCTGGCCTGAAGACGGCCCGGGACTTC
CTCGAGCCCGTCAAAG
CCAAGTTCCCCTGGATCACGCACTCGGACCTGTGGATCCTGTCGGGCGTCTGCGCCATCCAGGAGATGCTGGGCCCCAAGGTCCCCTTCCGGCCCGGCCGCTCC
GACAAGGACATGGCCGCCTGCACCCCCGACGGCCGCCTCCCCGACGCTACCCAGGGCGCCGACCACCTGAGGAACATCTTCTACCGCATGGGCTTCAACGACCAGGAGATTGTGGCCCTG
TCGGGCGGCCACGCCCTCGGCCGCTGCCACACGGACCGCAGCGGCTTCGACGGCCCGTGGACCTTCTCGCCCACCGTCCTGACCAACGACTTCTACAAGCTGCTGCTCGAGGAGAAGTGG
GACTGGAAGAAGTGGAACGGCCCCAAGCAG
TACGTCGACAAGAAGACCAAGACCCTGATGATGCTGCCCACCGACATGGTGCTCATCCAGGACAAGCAGTTCCTGCCGTGGGTCAAGAAG
TACGCTGCCGACAGCGACCTGTTCTTCAAGGACTTCTCCAACGTCGTCCTCAAGCTCTTTGAGCTTGGCGTGCCTTTTGCCCAGAGCAGCGAGAACCAGAGGTGGGTCTTCAAGTCGAGC
AGCGAGTAA

Retrieve as FASTA