Entry information : HanCIIBB02 (HanMnP02 / mnp5)
Entry ID 8495
Creation 2011-09-15 (Christophe Dunand)
Last sequence changes 2011-09-15 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-23 (Catherine Mathe (Scipio))
Peroxidase information: HanCIIBB02 (HanMnP02 / mnp5)
Name (synonym) HanCIIBB02 (HanMnP02 / mnp5)
Class Other class II peroxidase type B    [Orthogroup: CIIBB001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Bondarzewiaceae Heterobasidion
Organism Heterobasidion annosum (root rot fungus)    [TaxId: 13563 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HanCIIBB02
start..stop
S start..stop
PstrCIIBB02 584 0 1..356 1..359
HanCIIBB01 573 0 1..356 1..361
HanCIIBB07 566 0 1..356 1..361
HanCIIBB05 565 0 1..356 1..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 521008..521059 52 N° 2 521115..521310 196 N° 3 521367..521498 132 N° 4 521556..521677 122
N° 5 521731..521806 76 N° 6 521856..521981 126 N° 7 522039..522118 80 N° 8 522176..522211 36
N° 9 522265..522437 173 N° 10 522489..522553 65 N° 11 522612..522624 13  
join(521008..521059,521115..521310,521367..521498,521556..521677,521731..521806, 521856..521981,522039..522118,522176..522211,522265..522437,522489..522553,52261 2..522624)


exon

Literature and cross-references HanCIIBB02 (HanMnP02 / mnp5)
DNA ref. JGI genome:   scaffold_06 (521008..522624)
Cluster/Prediction ref. JGI gene:   6364
Protein sequence: HanCIIBB02 (HanMnP02 / mnp5)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   356 (338)
PWM (Da):   %s   37085.97 (35237.0)  
PI (pH):   %s   4.06 (4.06) Peptide Signal:   %s   cut: 19 range:19-356
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFQTLACFLALIAVANAAITRRVACPDGINTATNAACCALFAVRDDIQTNLFDGGECGEEVHESLRLTFHDAIGFSTTKNVGGGADGSISTFSDIETNFHANNGIDEIVEEQRPFVAAHNMTAGDFIQFAGAIGVSNCPGAPRLEFFFGRPTAIAPAADLTVPEPDTVDSILARFSDAGFTTAEVVALLASHTIAAADHVDPTIPGTPFDSTPSTFDTQFFVETQLRGTLFPGTGGNQGEVESPLAGEIRLQSDSELADSRTACLWQANVNQQTHMANSFAAAMAKLAVLGHNTADMIDCSELIPTPPPFANVATFPAGINSNDVEQCATTPFPTLGTDPGPVTSVAPVPPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCCAGACACTAGCCTGCTTCCTTGCTCTCATCGCTGTTGCAAATGGTGGGTACAGAGATTGACGCGATACTTGAATCGCGCTGACCGAATTTTACGACAGCTGCCATCACTAG
GCGTGTTGCTTGTCCCGATGGTATCAACACCGCTACAAACGCGGCATGCTGCGCGTTGTTTGCTGTCCGTGACGACATCCAGACAAACCTGTTTGATGGTGGCGAATGCGGTGAGGAGGT
GCACGAATCCCTCCGCCTGACCTTCCACGACGCGATCGGTTTCTCGACTACAAAGAATGTTGG
GTTAGTGCAAGTTTTTCTCCTGAAGAAAAACCTCACCTATCATATCGTCGTGATAGT
GGTGGTGCCGACGGCTCGATATCAACATTCTCCGACATCGAGACCAACTTCCATGCCAACAACGGCATCGATGAAATTGTTGAGGAACAAAGACCGTTCGTTGCTGCGCACAATATGACC
GCCGGAGATTT
GTGAGCACCGTGTATATGCAGCTTTGATGTCCTAGACTCACTGAAACATTTCTATAGCATCCAATTTGCAGGCGCTATTGGTGTTAGTAACTGCCCTGGTGCTCCTCGG
CTGGAATTCTTTTTTGGTCGTCCCACAGCGATAGCTCCGGCCGCCGATCTGACTGTCCCAGAGCCTTTTG
GTTGGTCTCAACGCTTTGTTTTTCCCCAATCCCTGACACGGTTCCATTTG
CAGATACCGTCGACAGCATTCTCGCCCGTTTCAGTGACGCTGGCTTCACCACAGCTGAAGTTGTCGCCCTCCTTGCCTCGTAAGCGATAAATACTTTGGCCTAACTTATTTGCTCATTCA
TGATGAAGCCACACGATCGCCGCGGCCGATCACGTTGACCCAACCATCCCTGGAACGCCATTCGACTCGACTCCGTCCACGTTCGACACTCAATTCTTTGTTGAGACCCAGCTTCGTGGA
ACACTCTTCCCAGG
GTACGACCATCTTGATCTAAGAAATTACTGCGCGGCTAATGTTTTGGTCTGGCATAGAACGGGTGGGAACCAGGGCGAGGTAGAGTCGCCTTTGGCGGGCGAGATT
CGGCTGCAGTCCGATTCAGAGCTGGCTAGAG
GTCTGTCGTGAGATCACCTCAAAGGATTTTCGCTGGCTTACGTACCATCCAACCTAGACTCTCGCACCGCTTGCCTATGGCAAGCCAAT
GTCA
GTGAGTATATATTGTGTACTATCCCGTTAGCTAGAAGTGACAACATTCTACAGACCAGCAGACTCACATGGCCAACTCTTTTGCTGCGGCGATGGCAAAGTTGGCTGTCCTCGGTC
ACAACACGGCTGACATGATTGACTGCTCGGAGCTGATCCCTACGCCTCCGCCCTTCGCCAACGTTGCCACCTTCCCAGCTGGGATCAACTCCAACGATGTAGAACAAGCG
GTACGTCGTT
TGAATTCTCAATGTAATTGTCTGGCTGACAGATAACTTCAGTGTGCCACTACTCCTTTCCCAACTCTCGGCACCGATCCTGGCCCAGTTACCTCGGTTGCCCCAGTGTAAGTTTTATTTT
ACTAACTTATGGAGCGTATATGTCTAACAATTTTTTTTCTATAGCCCTCCTTCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCCAGACACTAGCCTGCTTCCTTGCTCTCATCGCTGTTGCAAATGCTGCCATCACTAGGCGTGTTGCTTGTCCCGATGGTATCAACACCGCTACAAACGCGGCATGCTGCGCG
TTGTTTGCTGTCCGTGACGACATCCAGACAAACCTGTTTGATGGTGGCGAATGCGGTGAGGAGGTGCACGAATCCCTCCGCCTGACCTTCCACGACGCGATCGGTTTCTCGACTACAAAG
AATGTTGG
TGGTGGTGCCGACGGCTCGATATCAACATTCTCCGACATCGAGACCAACTTCCATGCCAACAACGGCATCGATGAAATTGTTGAGGAACAAAGACCGTTCGTTGCTGCGCAC
AATATGACCGCCGGAGATTT
CATCCAATTTGCAGGCGCTATTGGTGTTAGTAACTGCCCTGGTGCTCCTCGGCTGGAATTCTTTTTTGGTCGTCCCACAGCGATAGCTCCGGCCGCCGAT
CTGACTGTCCCAGAGCCTTTTG
ATACCGTCGACAGCATTCTCGCCCGTTTCAGTGACGCTGGCTTCACCACAGCTGAAGTTGTCGCCCTCCTTGCCTCCCACACGATCGCCGCGGCCGAT
CACGTTGACCCAACCATCCCTGGAACGCCATTCGACTCGACTCCGTCCACGTTCGACACTCAATTCTTTGTTGAGACCCAGCTTCGTGGAACACTCTTCCCAGG
AACGGGTGGGAACCAG
GGCGAGGTAGAGTCGCCTTTGGCGGGCGAGATTCGGCTGCAGTCCGATTCAGAGCTGGCTAGAG
ACTCTCGCACCGCTTGCCTATGGCAAGCCAATGTCAACCAGCAGACTCACATGGCC
AACTCTTTTGCTGCGGCGATGGCAAAGTTGGCTGTCCTCGGTCACAACACGGCTGACATGATTGACTGCTCGGAGCTGATCCCTACGCCTCCGCCCTTCGCCAACGTTGCCACCTTCCCA
GCTGGGATCAACTCCAACGATGTAGAACAAGCG
TGTGCCACTACTCCTTTCCCAACTCTCGGCACCGATCCTGGCCCAGTTACCTCGGTTGCCCCAGTCCCTCCTTCTTAA

Retrieve as FASTA