Entry information : HanCIIBB01 (MnP01)
Entry ID 8497
Creation 2011-09-15 (Christophe Dunand)
Last sequence changes 2012-04-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-09-15 (Christophe Dunand)
Peroxidase information: HanCIIBB01 (MnP01)
Name (synonym) HanCIIBB01 (MnP01)
Class Other class II peroxidase type B    [Orthogroup: CIIBB001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Bondarzewiaceae Heterobasidion
Organism Heterobasidion annosum (root rot fungus)    [TaxId: 13563 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HanCIIBB01
start..stop
S start..stop
HanCIIBB05 644 0 1..361 1..361
HanCIIBB02 588 0 1..361 1..356
HanCIIBB07 573 0 1..361 1..361
PstrCIIBB02 546 0 1..361 1..359
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1020651..1020702 52 N° 2 1020759..1020966 208 N° 3 1021028..1021162 135 N° 4 1021218..1021339 122
N° 5 1021394..1021469 76 N° 6 1021522..1021647 126 N° 7 1021702..1021781 80 N° 8 1021837..1021872 36
N° 9 1021931..1022103 173 N° 10 1022163..1022227 65 N° 11 1022279..1022291 13  
join(1020651..1020702,1020759..1020966,1021028..1021162,1021218..1021339,1021394 ..1021469,1021522..1021647,1021702..1021781,1021837..1021872,1021931..1022103,10 22163..1022227,1022279..1022291)


exon

Literature and cross-references HanCIIBB01 (MnP01)
DNA ref. JGI genome:   scaffold_11 (1020651..1022291)
mRNA ref. JGI transcript:   10471
Protein sequence: HanCIIBB01 (MnP01)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   361 (343)
PWM (Da):   %s   37425.43 (35688.5)  
PI (pH):   %s   4.02 (4.02) Peptide Signal:   %s   cut: 19 range:19-361
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFGTLVAFASLISVASAAITRRVACPDGVNTATNAACCALFAVRDDIQENLFDGGECGEDVHESLRLTFHDAIGFSLSANTAGTFGGGGADGSIIIFSSIETAFHANNGIDEIVEEQKPFIARHNITPGDFIQFAGAVGVSNCPGAPQLDFLLGRPAAVAPAPDLTVPEPATVDSILARFADTGFSTDEVVALLASHTIAAADKVDVTIPGTPFDSTPEMFDTQFFIETQLRGTLFPGTGGNQGEVESPLAGELRLQSDSELADSRTACLWQANVNQLEHMTTAFKAAMAKLAVLGQDPSQMVDCSELIPTPPPFTGAAHLPAGLTMNDIEQCAVTPFPTLPTDPGPITSVAAVPPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCGGAACTCTCGTCGCATTTGCATCTCTGATCAGCGTTGCCAGCGGTGGGTGCCCAATTATGCTGTAACTCACAGTCTGATTTATTTGACTTCGTTTTCAGCCGCCATCACAA
GGCGTGTTGCCTGCCCGGACGGGGTGAATACTGCTACCAACGCTGCTTGCTGCGCATTGTTCGCTGTCCGTGACGACATCCAGGAGAATTTGTTCGACGGCGGCGAGTGTGGTGAAGACG
TGCACGAGTCACTCCGTCTAACATTCCACGACGCTATTGGCTTCTCCCTCTCTGCTAATACTGCGGGCACTTTCGG
GTTTGTTTTCTGAATCAATCAAGTTTCTGTGTTCGCACTTATTT
TAAACGATTGTTGATAGCGGTGGAGGCGCTGACGGCTCTATCATCATCTTCTCCTCCATTGAGACCGCATTCCATGCCAACAACGGCATCGACGAGATCGTCGAGGAGCAGAAGCCGTTC
ATTGCTAGGCACAATATCACGCCAGGCGATTT
GTAAGTCCTCAGTTCATTCATATATTCCGCCGCTTGACTATCAACACGACTCTAGCATTCAATTCGCGGGTGCAGTCGGTGTCAGTAA
TTGTCCTGGTGCTCCGCAACTGGACTTCCTACTCGGTCGTCCTGCTGCTGTGGCTCCTGCTCCCGACTTGACTGTCCCTGAACCCTTTG
GTAAGGTGATCAGTGGTGATTGATGTCTTTG
CGCATGCTCACATTGATACACAGCTACTGTCGATAGTATCTTAGCACGCTTCGCTGATACTGGATTCAGTACTGATGAAGTCGTTGCATTGCTCGCATCGTAAGCGCATTCTATCCTTTC
AAATCCAAACCTGCTCACATCAGTAATCAAGGCATACTATTGCTGCTGCGGATAAGGTCGACGTGACAATTCCAGGAACTCCGTTCGACTCCACACCCGAAATGTTCGATACTCAATTCT
TCATTGAGACCCAGCTTCGTGGCACCCTTTTCCCAGG
GTAAGGTGTCGCGTGATCGCTGAAGGTCTCTGCCTCATGCTTCTCGCTATGTAGGACTGGTGGAAACCAAGGTGAAGTTGAAT
CGCCCTTGGCGGGAGAGCTGCGCCTCCAATCGGACTCGGAGTTGGCCAGAG
GTCTGTTCACGCTTATCTACAGAAGATAGTCCCTCATAAACTTGTGCCCGGTCAGACTCCCGCACTGCT
TGTTTGTGGCAGGCCAACGTTA
GTAAGTACTCATATCTCTCTTCATCGCGGTAATACTGCTGATGCGTCTGTACACGTAGACCAACTGGAACACATGACAACAGCATTCAAGGCAGCTAT
GGCCAAGCTAGCTGTTCTAGGACAGGACCCATCTCAGATGGTTGACTGTTCGGAACTGATCCCGACGCCTCCACCTTTCACTGGTGCTGCCCACCTGCCTGCCGGCCTGACGATGAACGA
CATTGAGCAAGCG
GTTAGTCATAATATTCTGTTGAGGAAGTACTCTTACTTACCACGTATCGTCAACCTCAGTGCGCAGTGACTCCATTCCCTACCCTGCCGACTGACCCTGGTCCGATC
ACCTCCGTTGCTGCTGT
GTATGTGCTTTCGCCTTCGGATGCGTGAATGATCTTCTCACTTTCCTACAGGCCTCCTTCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCGGAACTCTCGTCGCATTTGCATCTCTGATCAGCGTTGCCAGCGCCGCCATCACAAGGCGTGTTGCCTGCCCGGACGGGGTGAATACTGCTACCAACGCTGCTTGCTGCGCA
TTGTTCGCTGTCCGTGACGACATCCAGGAGAATTTGTTCGACGGCGGCGAGTGTGGTGAAGACGTGCACGAGTCACTCCGTCTAACATTCCACGACGCTATTGGCTTCTCCCTCTCTGCT
AATACTGCGGGCACTTTCGG
CGGTGGAGGCGCTGACGGCTCTATCATCATCTTCTCCTCCATTGAGACCGCATTCCATGCCAACAACGGCATCGACGAGATCGTCGAGGAGCAGAAGCCG
TTCATTGCTAGGCACAATATCACGCCAGGCGATTT
CATTCAATTCGCGGGTGCAGTCGGTGTCAGTAATTGTCCTGGTGCTCCGCAACTGGACTTCCTACTCGGTCGTCCTGCTGCTGTG
GCTCCTGCTCCCGACTTGACTGTCCCTGAACCCTTTG
CTACTGTCGATAGTATCTTAGCACGCTTCGCTGATACTGGATTCAGTACTGATGAAGTCGTTGCATTGCTCGCATCGCATACT
ATTGCTGCTGCGGATAAGGTCGACGTGACAATTCCAGGAACTCCGTTCGACTCCACACCCGAAATGTTCGATACTCAATTCTTCATTGAGACCCAGCTTCGTGGCACCCTTTTCCCAGG
G
ACTGGTGGAAACCAAGGTGAAGTTGAATCGCCCTTGGCGGGAGAGCTGCGCCTCCAATCGGACTCGGAGTTGGCCAGAG
ACTCCCGCACTGCTTGTTTGTGGCAGGCCAACGTTAACCAA
CTGGAACACATGACAACAGCATTCAAGGCAGCTATGGCCAAGCTAGCTGTTCTAGGACAGGACCCATCTCAGATGGTTGACTGTTCGGAACTGATCCCGACGCCTCCACCTTTCACTGGT
GCTGCCCACCTGCCTGCCGGCCTGACGATGAACGACATTGAGCAAGCG
TGCGCAGTGACTCCATTCCCTACCCTGCCGACTGACCCTGGTCCGATCACCTCCGTTGCTGCTGTGCCTCCT
TCTTAA

Retrieve as FASTA