Entry information : HanCIIBB07
Entry ID 8499
Creation 2011-09-15 (Christophe Dunand)
Last sequence changes 2011-09-15 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-06-13 (Catherine Mathe)
Peroxidase information: HanCIIBB07
Name HanCIIBB07
Class Other class II peroxidase type B    [Orthogroup: CIIBB001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Bondarzewiaceae Heterobasidion
Organism Heterobasidion annosum (root rot fungus)    [TaxId: 13563 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HanCIIBB07
start..stop
S start..stop
HanCIIBB02 566 0 1..361 1..356
PstrCIIBB02 562 0 1..361 1..359
HanCIIBB01 550 0 1..361 1..361
BaCIIBB03 551 0 5..361 8..364
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 429001..429052 52 N° 2 428731..428938 208 N° 3 428538..428672 135 N° 4 428354..428475 122
N° 5 428221..428296 76 N° 6 428039..428164 126 N° 7 427903..427982 80 N° 8 427818..427853 36
N° 9 427593..427765 173 N° 10 427475..427539 65 N° 11 427409..427421 13  
complement(join(427409..427421,427475..427539,427593..427765,427818..427853,4279 03..427982,428039..428164,428221..428296,428354..428475,428538..428672,428731..4 28938,429001..429052))


exon

Literature and cross-references HanCIIBB07
DNA ref. JGI genome:   scaffold_14 (429052..427409)
mRNA ref. JGI transcript:   11952
Protein sequence: HanCIIBB07
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   361 (343)
PWM (Da):   %s   37987.85 (36126.8)  
PI (pH):   %s   4.29 (4.25) Peptide Signal:   %s   cut: 19 range:19-361
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALKILSVFLTLFGAANAAITRHVACPDGINTATNAACCALFAIRDDIQENLFDGGECGEEVHESLRLTFHDAIGFSRAKRAAKQFGGGGADGSLIVFSDIETNYHANGGIDDIVEVQKPFIAAHNITPGDFIQFAGAIGVSNCPGAPRLEFLLGRPAPMAPAPDLTVPEPDTVDSILARFADVGISSDEVVALLASHSIAAADHVDPTIPGTPFDSTPSVFDSQFFVETQLRGTLFPGNGSNQGEVESPLRGEIRLQSDFELADSRTACSWQGFVDNQKKMASEFKNAMAKLAVLGQDISQMVDCSELIPEPKPLTVSARFPAGFTISDVEQCASTSFPTLATDPGPITSVAPVPPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns). The intron 2 is out of a conserved cintron (extra seq but confirmed with RNAseq data)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACTGAAGATCCTTTCCGTGTTCCTCACCCTCTTCGGTGCTGCCAACGGTGCGTTATTGCGCATCGCTTGACTTCTACAGGACTGACAGGACTGAATCGCTCGATCTCAGCGGCCA
TCACCCGGCACGTTGCGTGTCCTGACGGCATCAATACTGCGACAAATGCTGCCTGCTGTGCCCTGTTTGCCATCCGCGATGACATTCAAGAGAACTTGTTTGATGGAGGCGAGTGCGGAG
AGGAGGTGCACGAATCTCTCCGTCTCACGTTCCATGATGCAATCGGGTTCTCGCGAGCTAAACGAGCTGCCAAGCAATTCGG
GTAACGATTTTTCGTTTCAGTTTTTCGTACCGTGCATG
ATAATGTCCCACCATCATAGCGGCGGAGGCGCCGATGGCTCCCTCATCGTGTTCTCCGACATAGAAACAAATTACCACGCAAACGGTGGCATTGACGATATCGTAGAAGTACAAAAACCC
TTCATCGCCGCACATAACATCACCCCAGGCGATTT
GTATGTATTTTCCTCCAGTTGGACGACGAAAAGCTGAGCTGAGCTCTCTCCTACTGTTATAGCATTCAATTCGCAGGTGCGATCG
GTGTCAGCAACTGTCCTGGTGCTCCACGCCTGGAATTCCTTTTGGGTCGCCCCGCGCCCATGGCTCCTGCTCCTGACCTCACTGTTCCTGAGCCCTTCG
GTATGAAGTAACCGTTTTCTC
AGAAGTCATCGTAAAATTCACAGGAATATAATCTAGACACCGTTGACAGCATCTTGGCCCGCTTTGCTGATGTCGGCATATCGTCAGATGAGGTAGTTGCTTTACTTGCATCGTAAGTTC
TTCTAGTAGGCGAGTCAACACATGTGCATTGATATTCATGTTTCTCAGTCATTCCATTGCCGCTGCCGACCACGTAGATCCTACTATCCCCGGGACACCGTTCGACTCTACACCATCTGT
GTTTGATTCCCAATTTTTCGTAGAGACCCAACTCCGCGGTACGCTTTTCCCAGG
GTATGTATTTGGTACATCCATCCCAGAAATTCTCCTCAAACCAACTTTCGTATCAGAAATGGTAGC
AATCAGGGAGAAGTCGAATCTCCTTTACGGGGTGAGATCCGCTTGCAATCCGACTTCGAATTAGCCCGAG
GTTGGTGCTATCGCTACGGAATTGTTCGCTACTCATCACAATCACCCAGA
TTCTCGCACGGCGTGCTCTTGGCAAGGCTTTGTGG
GTGAGCACACATCGTTTTTACATCTGGAAATAAGGCGTTGACCTTTGTTCAGATAACCAGAAGAAGATGGCGTCCGAATTCAAAA
ACGCTATGGCCAAACTAGCCGTCCTAGGACAGGATATCTCTCAAATGGTGGACTGCAGCGAGTTGATCCCTGAGCCGAAGCCGTTAACAGTTTCGGCTCGCTTCCCTGCTGGGTTCACCA
TCAGTGATGTCGAACAGGCG
GTAAAAAGTCATCCTATTTCTACAATTATCAAGGTACTGATACCTATGAGCAGTGCGCTTCCACCTCGTTCCCTACGCTGGCAACCGATCCCGGCCCTAT
AACTTCAGTTGCCCCTGT
GTAAGTTATGAGGCCTTGTCGCGTGAACCGATTGTTAAACAGATGTTGTACAGGCCTCCTTCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACTGAAGATCCTTTCCGTGTTCCTCACCCTCTTCGGTGCTGCCAACGCGGCCATCACCCGGCACGTTGCGTGTCCTGACGGCATCAATACTGCGACAAATGCTGCCTGCTGTGCC
CTGTTTGCCATCCGCGATGACATTCAAGAGAACTTGTTTGATGGAGGCGAGTGCGGAGAGGAGGTGCACGAATCTCTCCGTCTCACGTTCCATGATGCAATCGGGTTCTCGCGAGCTAAA
CGAGCTGCCAAGCAATTCGG
CGGCGGAGGCGCCGATGGCTCCCTCATCGTGTTCTCCGACATAGAAACAAATTACCACGCAAACGGTGGCATTGACGATATCGTAGAAGTACAAAAACCC
TTCATCGCCGCACATAACATCACCCCAGGCGATTT
CATTCAATTCGCAGGTGCGATCGGTGTCAGCAACTGTCCTGGTGCTCCACGCCTGGAATTCCTTTTGGGTCGCCCCGCGCCCATG
GCTCCTGCTCCTGACCTCACTGTTCCTGAGCCCTTCG
ACACCGTTGACAGCATCTTGGCCCGCTTTGCTGATGTCGGCATATCGTCAGATGAGGTAGTTGCTTTACTTGCATCTCATTCC
ATTGCCGCTGCCGACCACGTAGATCCTACTATCCCCGGGACACCGTTCGACTCTACACCATCTGTGTTTGATTCCCAATTTTTCGTAGAGACCCAACTCCGCGGTACGCTTTTCCCAGG
A
AATGGTAGCAATCAGGGAGAAGTCGAATCTCCTTTACGGGGTGAGATCCGCTTGCAATCCGACTTCGAATTAGCCCGAG
ATTCTCGCACGGCGTGCTCTTGGCAAGGCTTTGTGGATAAC
CAGAAGAAGATGGCGTCCGAATTCAAAAACGCTATGGCCAAACTAGCCGTCCTAGGACAGGATATCTCTCAAATGGTGGACTGCAGCGAGTTGATCCCTGAGCCGAAGCCGTTAACAGTT
TCGGCTCGCTTCCCTGCTGGGTTCACCATCAGTGATGTCGAACAGGCG
TGCGCTTCCACCTCGTTCCCTACGCTGGCAACCGATCCCGGCCCTATAACTTCAGTTGCCCCTGTGCCTCCT
TCCTAA

Retrieve as FASTA