Entry information : 09(At1g44970 / PER9 / Atatp418a / Atp18a / AtP18 / AtperoxP9)
Entry ID 85
Creation 2006-02-02 (Filippo Passardi)
Last sequence changes 2015-06-02 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2020-03-04 (Christophe Dunand)
Peroxidase information: 09(At1g44970 / PER9 / Atatp418a / Atp18a / AtP18 / AtperoxP9)
Name 09(At1g44970 / PER9 / Atatp418a / Atp18a / AtP18 / AtperoxP9)
Class Class III peroxidase    [Orthogroup: Prx037]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue types Flower buds
Flowers
Roots
Siliques
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value 09
start..stop
S start..stop
AlyPrx09 677 0 1..346 1..346
AhalPrx34 673 0 1..346 1..346
BstrPrx25 654 0 1..346 21..366
CrubPrx52 652 0 1..346 1..346
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 17002237..17002506 270 N° 2 17002592..17002783 192 N° 3 17002870..17003035 166 N° 4 17003151..17003563 413
join(17002237..17002506,17002592..17002783,17002870..17003035,17003151..17003563 )


exon

Literature and cross-references 09(At1g44970 / PER9 / Atatp418a / Atp18a / AtP18 / AtperoxP9)
Literature REFERENCE 1 Jacobowitz JR, Doyle WC, Weng JK. PRX9 and PRX40 Are Extensin Peroxidases Essential for Maintaining Tapetum and Microspore Cell Wall Integrity during Arabidopsis Anther Development. Plant Cell. 2019 Apr;31(4):848-861.
Protein ref. UniProtKB:   Q96512
DNA ref. Phytozome 11:   Chr1 (17002237..17003563)
mRNA ref. GenBank:   NM_103577
Cluster/Prediction ref. Genebank:   841062 Phytozome Gene 11:   19653505 UniGene:   At.140
Omic ref. AtProteome:   At1g44970 ATTED-II:   At1g44970 e-FP Browser:   At1g44970 ePlant:   At1g44970 Genevestigator:   At1g44970 TAIR:   At1g44970
Protein sequence: 09(At1g44970 / PER9 / Atatp418a / Atp18a / AtP18 / AtperoxP9)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   100 (323)
PWM (Da):   %s   10835.55 (35111.6)  
PI (pH):   %s   6.51 (7.36) Peptide Signal:   %s   cut: 24 range:24-346
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAISKLIPTLVLFVLFSFDVSVAHPGLGFGWGSNSPIGGSFYSNLYPQFYQFSCPQADEIVMTVLEKAIAKEPRMAASLLRLHFHDCFVQGCDASILLDDSATIRSEKNAGPNKNSVRGFQVIDEIKAKLEQACPQTVSCADILALAARGSTILSGGPSWELPLGRRDSRTASLNGANTNIPAPNSTIQNLLTMFQRKGLNEEDLVSLSGGHTIGVARCTTFKQRLYNQNGNNQPDETLERSYYYGLRSICPPTGGDNNISPLDLASPARFDNTYFKLLLWGKGLLTSDEVLLTGNVGKTGALVKAYAEDERLFFQQFAKSMVNMGNIQPLTGFNGEIRKSCHVIN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns), 5 cDNA and 11 ESTs. Roots expression?
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGTAAGATAA CACCGTTGTT CACCAAAAAG GCGGAGAAGA TGCATGATAT TTTCTTGCGA GATTTAGATG GATGTCTTCA GATTCTATAA TGGTGTTTGG ATAAGAGTGG TTGTTGTCTT  GTGTATGTGA CGGAGATGTA AAGAACCGTT AGATGCTTGT CATTTGCTTG TTAATATATG CTAGGGAATG ATTTGCAATA TTCACATTTA TGCTGGATTT TTACATGGCT TCATAGAAAC  TATATGCTTC ATTAGTAACA CTCTGATTTA GTTTAAGTTA TCGATTTCTG AGATTTTACT TGGAGATGTA GAATAAACTC TTTTGTTGGT TTTGATTGTC CTGCTATCGC TGAAACCTCC  GTATACAGAA GTTTTCACGA AAATCCATTC TACTCTAAGC ATTATAGGAA GTGGATCTTT GTGTAAAGAA ATGATGTCAT TTTGGCTGTT CAGAGGAAAA CTAACACCGT TATTCGCCAA  AAAGGCGGAG AAGATGCATG TCTTCCTATT CTATAATGGT GTGTGGATGA GATTGGTTGT TTTCTTGTGT ATGTGATGGA TATGTATGGA CTAATTGTTA AATGCATGCT GTGATTCTAA  TTGCCAATTA ATATATGTAG GAGAATGCAA CTAGGATGTT GATTAACCTT AGCAATGTGA TATGCAGTTT TATTTATTTA TCTATCTATT GGGAGCACTT GCATTCTCTC ATACTTTTTT  GAATTTTCAG GTTTGTTTTT AAGAGTTCCA CCAGAGCTAC AGGGTGGGCG CATAGCAACA AGTACTTCAA TATTCTCTCA AGAGGAGTTG AGCGCGATGG TTGGAAGTTT GTTCTTCTTG  CAAGGTTCTC GCCCATTCCT TCCTATGTCA TAAACTACGC TTTGGCAGCT ACTGAAGTCC GGTTTGTAGC TGATTTTCTG TTCCCCACGG TTATTGGCTG CCTCCCGATG ATCCTGCAGA  ACGCATCAGT CGGTAGCCTC GCTGGTATGG CTGTGGCTTC AGTAGCTGGA AAACAGAAAA GTCAGGTCTG GGGTTATGTT TTCCCAGTAC TTGGGATACT GTCAAGTGTT CTGATTTCAT  TGAGGATCAA AAAGTACTCA GCTGGAATTA CAGAGGCATC ATCAGATACC TCTGCTAACA ACTCTAGTTT AGCTTCATCT GAAACTGCGA ATCCCGCTTA TGGAACCGAT GGATCCAAGA  AAAGTGAGTG ATTATACAAA CCATGATGGT GGTTTTTGAT CGCCGGTATT ACACTTTGTT TGGTTTGCAG CTATCAGATT CTCAACATCA TGGCTTATTT TGGACGAGTT AGGCAGTATC  TTAATAGTAA CAAAGCATTA GTTTTTGTAC TTCTTAAGTT AAAAGCTTAG AACAAAACAA CAGTGTTATT TTCTATACCA GACACAAAAA CTGTGTCGTT GTAATAACAC TTACCATAAC  ATTTTCTTTC AGTGTATGTT TAAAGCCGTT TATATGGTTG AAGCAATGTG ACTAAAATTT TTGTAGCATT GAAACAAGCT ATATTTGCAT TGCTATGGTC TTGTTTTGTG ACTAAAAGAC  TTGGATGCAG AATGGATATA AGTTAAATGT CTGATTTTGT AAATAACTTA TGAAGAGAAA ATCTTTATTC GGTAAGAGTT GTTTTCTCAA TGTAGCAGTT CACTCATCAT TTTCAAACTT  CAACTCTCAG AGAACACAAA GAGGTTAGAC AGTGCAGATG CTTATGGTTG AGAAGCTTTA CCTAACAATG GTACAAGGCG GTTTTGTTGG GATCACATGT GAAGTTAGGC ACATGGATTC  GTTCTTGGAG TTGGTACAAG GACTTCTAAA AGACAACAAT GAGGTATAAT AAGGACAAGT TGACTATGTC TCTCTCTTTT ATCTTAACAT TCTAAATTAG GATTTGGTAA ACTGAGAGCA 
GTTAGCTTCT TGAATCTCTA AAGTATAAAA ACCCTCACCG TTTTACTACT ATCTCATCTT AAAACTCCCA AGTAACAAAA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AGAAACTGTG TGTTTTTGCA TTATTATTGT ATTAAGGGGT GATTAAGAAT AAGTCGTGTT ATGTTTTTCG ATATGTTAGT GATCTAATTA ACGTCTTTGA ATGAAAATGG ACGGTTGTTT  TAAGAGGTGA ACATGAAAAT ATGGTAGTTT TTACTGTATT CTTTATTTGG GTTGCGTCCG TCTTAAGACA ACAAGTATCT TCAGACTGCA GTTGTCAAAG CGAGTAACCC TGTTTAAATA  TTTGTAAGTA CCGGTCACAA ACAAGTACTT AGAATGATAC AATATTCTAT TAATTTATAG AAGCATTATT TATCTATAAA TTATACTTAT TAATTTATAG AAAGTTTTTT CTATCCACTA  ATAAGATTTT TTCATTATAA AAATTATCTT TCTAGAATTA ATTATCAATG TTTAGAAGAC AATACCAAAC TTTTTTAATG CAATAAAAAT ATTTGAAATG AACTATAACA AAAACTAATG  CGGATTTAAG AAAAAGCAAA CAATATTAGA GTTATATTTC ACTAAAGTTT TCTAAATAAT AATCATTAAA AATTAAAATT AGATTATCGA TTTTATTTTA AATGTAAGCT AATGAAAACA  GGTAGCAAGT ATTTTGTAAA TAACTAGATC TGGACCTTCG GTGTATCATG TTTCTCACTT TTTCATTTTT GATTCTTTTT AAGTATCATG AATTATCCAT CCATGTGAAC AATTTGGCAG  AACTGGAAAA CCGCCGCCGC GTTTCCACAA ATAAAATCTA CAGTGTCCAT AAGAAAGTAT TCCCTATAAC ACTGGCGGTT TTTGTGAGGA TACAAGGCAT CCTGATATTC CTCGACACGA  CATCTGTAAA TGATGGACAT ATCACCATTC ACACGGAGGG TAACAACTGG TCCTTTCACC GGCCATGTCG TGTTTCGGAA GCACATGTCT ACTCTGATGA ATCCATCACC ATTAGAAGCT 
TCGAACATAT TTTTAGTATG ATGTCTTTAA GAATGTTATA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTATCTCAAAGCTTATTCCTACTCTTGTGCTCTTTGTTTTGTTCTCTTTTGATGTTAGTGTTGCTCATCCAGGTCTAGGATTTGGATGGGGAAGTAATAGTCCCATTGGAGGATCT
TTTTACTCAAATCTTTACCCACAATTTTACCAGTTCTCTTGTCCACAAGCTGATGAGATTGTTATGACGGTGCTCGAAAAAGCCATAGCTAAAGAACCAAGAATGGCAGCATCTTTACTC
AGACTTCACTTCCACGACTGCTTCGTTCAG
GTAAAAGTATCTTTACCTATTTTTGTTTTCCCTTTATGTGTCTCTTAAGCTTAACACTTATACACTACACTCTGTGTGTAAACAGGGCTG
TGATGCATCAATCTTGTTGGATGATAGTGCAACCATAAGAAGTGAAAAGAATGCTGGACCAAACAAGAACTCCGTTAGAGGGTTTCAAGTAATCGACGAGATCAAAGCCAAACTTGAGCA
AGCTTGTCCTCAAACTGTCTCCTGCGCCGACATTCTAGCTCTAGCTGCTCGTGGCTCAACTATACTG
GTAAAATTAAGAGACCTTCAAGAGAAACTATTGGCTCAGTTACAAGTTATATA
GCTTATATTTATCGAATTTGTGGTTCAATGCAGAGTGGTGGACCATCATGGGAGCTTCCACTAGGGAGGAGAGACTCGAGGACCGCTAGCCTTAATGGCGCAAACACGAACATTCCTGCA
CCTAACTCAACTATTCAAAATCTCTTAACCATGTTCCAACGTAAAGGTTTGAACGAAGAAGACCTTGTTTCCCTATCAG
GTGAGATTAACATGTATTTATCTTTTGTTTAAGGAGTTGGC
AAGGAAACCAAACCGAGACCGGTTTCTTAAAACCGAATGATAACAACGTTTTTAACCAAACCAAAATGTTGCAGGAGGACATACGATTGGAGTAGCGAGGTGCACAACGTTTAAACAAAG
ACTATACAATCAAAACGGTAATAACCAACCAGACGAGACGCTAGAGAGGTCTTACTACTATGGTCTCAGGTCAATTTGTCCACCAACAGGCGGTGACAACAATATTTCACCTCTAGACTT
AGCCTCTCCTGCAAGATTCGACAACACATACTTCAAGCTCCTTCTATGGGGCAAAGGCTTATTGACATCAGATGAAGTGCTTCTCACTGGCAATGTAGGCAAGACTGGTGCATTAGTGAA
AGCTTATGCCGAAGACGAGAGACTTTTCTTCCAACAATTCGCAAAGTCGATGGTTAACATGGGAAACATTCAGCCTCTTACTGGTTTTAATGGTGAGATCAGGAAGAGTTGTCATGTGAT
TAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTATCTCAAAGCTTATTCCTACTCTTGTGCTCTTTGTTTTGTTCTCTTTTGATGTTAGTGTTGCTCATCCAGGTCTAGGATTTGGATGGGGAAGTAATAGTCCCATTGGAGGATCT
TTTTACTCAAATCTTTACCCACAATTTTACCAGTTCTCTTGTCCACAAGCTGATGAGATTGTTATGACGGTGCTCGAAAAAGCCATAGCTAAAGAACCAAGAATGGCAGCATCTTTACTC
AGACTTCACTTCCACGACTGCTTCGTTCAG
GGCTGTGATGCATCAATCTTGTTGGATGATAGTGCAACCATAAGAAGTGAAAAGAATGCTGGACCAAACAAGAACTCCGTTAGAGGGTTT
CAAGTAATCGACGAGATCAAAGCCAAACTTGAGCAAGCTTGTCCTCAAACTGTCTCCTGCGCCGACATTCTAGCTCTAGCTGCTCGTGGCTCAACTATACTG
AGTGGTGGACCATCATGG
GAGCTTCCACTAGGGAGGAGAGACTCGAGGACCGCTAGCCTTAATGGCGCAAACACGAACATTCCTGCACCTAACTCAACTATTCAAAATCTCTTAACCATGTTCCAACGTAAAGGTTTG
AACGAAGAAGACCTTGTTTCCCTATCAG
GAGGACATACGATTGGAGTAGCGAGGTGCACAACGTTTAAACAAAGACTATACAATCAAAACGGTAATAACCAACCAGACGAGACGCTAGAG
AGGTCTTACTACTATGGTCTCAGGTCAATTTGTCCACCAACAGGCGGTGACAACAATATTTCACCTCTAGACTTAGCCTCTCCTGCAAGATTCGACAACACATACTTCAAGCTCCTTCTA
TGGGGCAAAGGCTTATTGACATCAGATGAAGTGCTTCTCACTGGCAATGTAGGCAAGACTGGTGCATTAGTGAAAGCTTATGCCGAAGACGAGAGACTTTTCTTCCAACAATTCGCAAAG
TCGATGGTTAACATGGGAAACATTCAGCCTCTTACTGGTTTTAATGGTGAGATCAGGAAGAGTTGTCATGTGATTAACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATCTTAACAT TCTAAATTAG GATTTGGTAA ACTGAGAGCA GTTAGCTTCT TGAATCTCTA AAGTATAAAA ACCCTCACCG TTTTACTACT ATCTCATCTT AAAACTCCCA AGTAACAAAA  ATGGCTATCT CAAAGCTTAT TCCTACTCTT GTGCTCTTTG TTTTGTTCTC TTTTGATGTT AGTGTTGCTC ATCCAGGTCT AGGATTTGGA TGGGGAAGTA ATAGTCCCAT TGGAGGATCT  TTTTACTCAA ATCTTTACCC ACAATTTTAC CAGTTCTCTT GTCCACAAGC TGATGAGATT GTTATGACGG TGCTCGAAAA AGCCATAGCT AAAGAACCAA GAATGGCAGC ATCTTTACTC  AGACTTCACT TCCACGACTG CTTCGTTCAG GGCTGTGATG CATCAATCTT GTTGGATGAT AGTGCAACCA TAAGAAGTGA AAAGAATGCT GGACCAAACA AGAACTCCGT TAGAGGGTTT  CAAGTAATCG ACGAGATCAA AGCCAAACTT GAGCAAGCTT GTCCTCAAAC TGTCTCCTGC GCCGACATTC TAGCTCTAGC TGCTCGTGGC TCAACTATAC TGAGTGGTGG ACCATCATGG  GAGCTTCCAC TAGGGAGGAG AGACTCGAGG ACCGCTAGCC TTAATGGCGC AAACACGAAC ATTCCTGCAC CTAACTCAAC TATTCAAAAT CTCTTAACCA TGTTCCAACG TAAAGGTTTG  AACGAAGAAG ACCTTGTTTC CCTATCAGGA GGACATACGA TTGGAGTAGC GAGGTGCACA ACGTTTAAAC AAAGACTATA CAATCAAAAC GGTAATAACC AACCAGACGA GACGCTAGAG  AGGTCTTACT ACTATGGTCT CAGGTCAATT TGTCCACCAA CAGGCGGTGA CAACAATATT TCACCTCTAG ACTTAGCCTC TCCTGCAAGA TTCGACAACA CATACTTCAA GCTCCTTCTA  TGGGGCAAAG GCTTATTGAC ATCAGATGAA GTGCTTCTCA CTGGCAATGT AGGCAAGACT GGTGCATTAG TGAAAGCTTA TGCCGAAGAC GAGAGACTTT TCTTCCAACA ATTCGCAAAG  TCGATGGTTA ACATGGGAAA CATTCAGCCT CTTACTGGTT TTAATGGTGA GATCAGGAAG AGTTGTCATG TGATTAACTA AAGAAACTGT GTGTTTTTGC ATTATTATTG TATTAAGGGG 
TGATTAAGAA TAAGTCGTGT TATGTTTTTC GATATGTTAG TGATCTAATT AACGTCTTTG AATGAAAATG GACGGTTGTT TTAAGA 

Retrieve as FASTA