Entry information : SbPrx145 (Sobic.K026900.1 [2.1] / Sb2674s002010 [1.4] / SB00G02335)
Entry ID 850
Creation 2006-01-17 (Christophe Dunand)
Last sequence changes 2006-01-17
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-08-05 (Christophe Dunand)
Peroxidase information: SbPrx145 (Sobic.K026900.1 [2.1] / Sb2674s002010 [1.4] / SB00G02335)
Name (synonym) SbPrx145 (Sobic.K026900.1 [2.1] / Sb2674s002010 [1.4] / SB00G02335)
Class Class III peroxidase    [Orthogroup: Prx053]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Roots
Seedlings
Inducers Acid treatment
Alkaline treatment
Ethylene treatment
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx145
start..stop
S start..stop
SiPrx30 604 0 1..329 1..329
SbPrx129 602 0 1..329 5..332
SiPrx31 598 0 1..329 1..328
SbPrx130 580 0 21..329 30..339
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1579..1800 222 N° 2 2003..2770 768  
join(1579..1800,2003..2770)


exon

Literature and cross-references SbPrx145 (Sobic.K026900.1 [2.1] / Sb2674s002010 [1.4] / SB00G02335)
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 11:   super_2674 (1579..2770)
Protein sequence: SbPrx145 (Sobic.K026900.1 [2.1] / Sb2674s002010 [1.4] / SB00G02335)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (302)
PWM (Da):   %s   35544.11 (32740.5) Transmb domain:   %s   i5-27o
PI (pH):   %s   7.99 (7.73) Peptide Signal:   %s   cut: 28 range:28-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAIKHFVVMLLPMALLLLATGSSPVVAQLELGYYSKTCPNAEAIVRAEMEKIISAAPSLAGPLLRLHFHDCFVRGCDASVLLDSTEGNLAERDAKPNKSLRGFGSVERVKAKLEAACPNTVSCADVLTLMARDAVVLAKGPSWPVALGRRDGRVSSATEAAEQLPPAHGDIPLLTKIFASKGLDVKDLAVLSGAHTLGTAHCPSYAGRLYNYSSAYNADPSLDSEYADRLRTRCKSVDDRAMLSEMDPGSYKTFDTSYYRHVAKRRGLFQSDAALLTDATTREYVQRIATGKFDDVFFKDFSESMIKMGNVGVITGADGEIRKKCYIVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (unknown chromo, intron 1) and 3 ESTs (TC106275, SCADIL, GGP and GGRD sequences are missing) and 1 EST (CD428559, 3'is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATTAAGCATTTTGTAGTTATGCTGCTGCCTATGGCCCTCCTGCTCCTCGCAACAGGTAGCTCACCGGTGGTGGCTCAGCTGGAGCTCGGCTACTACAGCAAGACATGCCCGAAC
GCCGAGGCGATCGTCCGCGCCGAGATGGAGAAGATCATCTCAGCTGCACCCAGCCTTGCTGGCCCGCTCCTCAGGCTTCATTTCCACGACTGCTTTGTCAGG
GTAAGTTCGTTACACCTA
GCTATTCAACAATGGCGCACAAACGTCGTATCGTATCGTATTCGCCAGTTTAATTTGTCGTAGTACATATACTTCTAGTCATCATTGTGTGTATCCAGCACTAGCATTGATCGACGTTTG
CGCTGATCGCAATGGAGCTGACAGAAAACCAAACAATGCTCATGCTCGCATCACAAAATTGCAGGGATGTGACGCTTCTGTCCTGCTCGACTCCACCGAGGGCAACCTGGCAGAGAGGGA
CGCCAAGCCGAACAAGAGCCTCCGGGGATTTGGTTCCGTGGAGAGGGTGAAGGCCAAGCTCGAGGCCGCCTGCCCTAACACCGTTTCCTGTGCCGACGTCCTCACCCTCATGGCCCGTGA
TGCCGTTGTGCTGGCCAAGGGCCCCTCCTGGCCGGTGGCGCTCGGGAGGCGAGACGGCCGTGTGTCCAGCGCAACGGAGGCGGCCGAGCAGCTACCCCCAGCGCACGGTGACATCCCCCT
GCTCACCAAGATTTTCGCTTCCAAAGGCCTCGACGTCAAGGACCTCGCCGTCCTCTCCGGCGCGCATACCCTTGGCACGGCGCACTGCCCGTCCTACGCCGGCCGGCTCTACAACTACAG
CAGCGCCTACAACGCGGACCCCTCCCTCGACAGCGAGTACGCCGACAGGCTCAGGACGCGCTGCAAGAGCGTCGACGACAGGGCCATGCTTTCCGAGATGGATCCCGGCAGCTACAAGAC
CTTCGACACGAGCTACTATCGCCACGTTGCCAAGCGCAGGGGACTGTTCCAGTCCGACGCCGCGCTCCTCACCGATGCAACCACCAGGGAGTACGTCCAGCGCATTGCCACTGGCAAGTT
CGACGACGTGTTCTTTAAGGACTTCAGCGAGTCCATGATCAAGATGGGCAACGTTGGCGTGATCACCGGTGCTGACGGGGAAATTAGGAAGAAATGCTACATCGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATTAAGCATTTTGTAGTTATGCTGCTGCCTATGGCCCTCCTGCTCCTCGCAACAGGTAGCTCACCGGTGGTGGCTCAGCTGGAGCTCGGCTACTACAGCAAGACATGCCCGAAC
GCCGAGGCGATCGTCCGCGCCGAGATGGAGAAGATCATCTCAGCTGCACCCAGCCTTGCTGGCCCGCTCCTCAGGCTTCATTTCCACGACTGCTTTGTCAGG
GGATGTGACGCTTCTGTC
CTGCTCGACTCCACCGAGGGCAACCTGGCAGAGAGGGACGCCAAGCCGAACAAGAGCCTCCGGGGATTTGGTTCCGTGGAGAGGGTGAAGGCCAAGCTCGAGGCCGCCTGCCCTAACACC
GTTTCCTGTGCCGACGTCCTCACCCTCATGGCCCGTGATGCCGTTGTGCTGGCCAAGGGCCCCTCCTGGCCGGTGGCGCTCGGGAGGCGAGACGGCCGTGTGTCCAGCGCAACGGAGGCG
GCCGAGCAGCTACCCCCAGCGCACGGTGACATCCCCCTGCTCACCAAGATTTTCGCTTCCAAAGGCCTCGACGTCAAGGACCTCGCCGTCCTCTCCGGCGCGCATACCCTTGGCACGGCG
CACTGCCCGTCCTACGCCGGCCGGCTCTACAACTACAGCAGCGCCTACAACGCGGACCCCTCCCTCGACAGCGAGTACGCCGACAGGCTCAGGACGCGCTGCAAGAGCGTCGACGACAGG
GCCATGCTTTCCGAGATGGATCCCGGCAGCTACAAGACCTTCGACACGAGCTACTATCGCCACGTTGCCAAGCGCAGGGGACTGTTCCAGTCCGACGCCGCGCTCCTCACCGATGCAACC
ACCAGGGAGTACGTCCAGCGCATTGCCACTGGCAAGTTCGACGACGTGTTCTTTAAGGACTTCAGCGAGTCCATGATCAAGATGGGCAACGTTGGCGTGATCACCGGTGCTGACGGGGAA
ATTAGGAAGAAATGCTACATCGTCAACTAA

Retrieve as FASTA