Entry information : FpinCIIBA
Entry ID 8500
Creation 2011-09-20 (Christophe Dunand)
Last sequence changes 2012-11-06 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-02-18 (Catherine Mathe)
Peroxidase information: FpinCIIBA
Name FpinCIIBA
Class Other class II peroxidase type A    [Orthogroup: CIIBA001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Fomitopsis
Organism Fomitopsis pinicola    [TaxId: 40483 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value FpinCIIBA
start..stop
S start..stop
DqueCIIBB01 407 4e-144 52..315 1..264
LsulCIIBA01 387 2e-135 43..325 39..321
WcoCIIBA 385 7e-135 42..318 24..300
PplCIIBA 362 5e-126 47..320 12..285
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 577390..577515 126 N° 2 577322..577339 18 N° 3 577244..577269 26 N° 4 577087..577191 105
N° 5 576973..577028 56 N° 6 576841..576919 79 N° 7 576498..576792 295 N° 8 576303..576447 145
N° 9 576089..576237 149  
complement(join(576089..576237,576303..576447,576498..576792,576841..576919,5769 73..577028,577087..577191,577244..577269,577322..577339,577390..577515))


exon

Literature and cross-references FpinCIIBA
DNA ref. JGI genome:   scaffold_3 (577515..576089)
Cluster/Prediction ref. JGI gene:   281595
Protein sequence: FpinCIIBA
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332 (312)
PWM (Da):   %s   34690.32 (32688.2)  
PI (pH):   %s   5.32 (5.12) Peptide Signal:   %s   cut: 21 range:21-332
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMLRLASLFSLASALGVALGATSPHFLSVDASEPSLAFAPEECRKWMKIMPVLQANIFDEGQCNDQAREAIRLTFHDGVGRSTILEKAGAFSGGGADGSIIRFAETELAPANDGLENIVLSLQDVADNHNVSYGDIIQFAGAVGLSNCPGSPRLPFYAGRPNAVAPSPPGLVPSPTDDADTILARMSDAGFTAEDTVALLAAHSVARQKTVDPSVPNVPFDSTPGAFDTKFYAMLLKGMGYPGKGGNSAEVKSASKHVMRLASDAALAQHPITSALWRSFAGDHNAMRAAFRDAMQKLANQGHAGLVNCSSVIPLPAPLQDRPGVQDSIL

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns). Concerved residues are missing in 3'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGCTCAGGCTAGCATCGCTTTTTTCTCTTGCCTCTGCCCTCGGCGTCGCACTGGGTGCGACAAGCCCGCATTTCCTTTCTGTCGACGCCAGTGAGCCATCACTGGCGTTTGCGCCG
GAGGAG
GTGTGCCACCATGTATACAACTTATCCCATGTTTCTGACTATGACTGAAGTGTAGAAAGTGGATGAAGGTACGAGCTACGTTCAAACCATCCTTACGCGTGTAACAATGCATCG
AGGTAGATTATGCCCGTGCTTCAGGCGAACATGTAAGTCAATTTATCCTTAGGGCCCTCCAGCTGTCAAGAAACTGTACACCAGATTCGACGAAGGCCAATGTAATGATCAAGCACGAGA
GGCCATTCGGCTCACCTTTCATGATGGGGTGGGCAGGTCTACCATCCTTGAAAAAGCCGGCGCATTTTC
GTAAGAATGTCGGCCTTGCTATGAGTGTGACCACACTGACCACACCTCTAT
ATTCTAGAGGCGGCGGTGCGGACGGAAGCATCATTCGCTTTGCAGAGACCGAGCTAGCTAATCGTACGTATGTTGAGCCCGTCGCACGTAGTCTAATCGCATCACACCTTGCACAGCTGC
GAACGATGGCCTAGAAAACATCGTCCTATCTCTCCAAGACGTCGCCGACAACCACAACGTCTCGTATGGCGATAT
GTACGTTCCAGAAATCTTGCTCTAGATTCTGGGGCCGACTCCGCG
TAGAATACAGTTCGCTGGTGCAGTCGGCCTCTCCAACTGCCCAGGGAGCCCCCGCCTCCCGTTCTACGCCGGACGGCCTAACGCCGTCGCACCCTCGCCGCCCGGTCTCGTTCCCTCCCC
AACCGACGACGCCGACACCATATTGGCGCGTATGTCCGACGCAGGATTCACCGCAGAAGACACGGTAGCCCTTCTTGCCGCACACTCAGTCGCAAGGCAGAAGACGGTTGACCCCAGTGT
ACCGAACGTGCCGTTCGACAGCACGCCCGGGGCGTTCGACACGAAATTTTACGCAGAG
GTGCGTATTATCGGCGCGCTCGCGCGACATTGGAACTGACGTGATCCCAGATGTTGCTCAAG
GGCATGGGCTACCCTGGCAAGGGCGGGAACTCCGCTGAGGTGAAGTCCGCGTCCAAGCATGTCATGCGCCTTGCCTCCGACGCGGCACTCGCCCAACACCCGATTACATCCGCCCTCTGG
CGTTCTTTCGCAG
GTGGGCAGCCTTCACTGGCATCGCCGTGCACCCATCCCACACCACACTCACCGGGACCTCCTTAGGCGATCACAACGCTATGCGTGCGGCGTTCCGGGACGCCATGC
AGAAGCTCGCAAACCAGGGCCACGCCGGCCTCGTCAACTGTTCCTCCGTCATCCCCCTTCCCGCACCGCTGCAAGACCGCCCGGGTGTACAGGACAGTATACTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGCTCAGGCTAGCATCGCTTTTTTCTCTTGCCTCTGCCCTCGGCGTCGCACTGGGTGCGACAAGCCCGCATTTCCTTTCTGTCGACGCCAGTGAGCCATCACTGGCGTTTGCGCCG
GAGGAG
TGTAGAAAGTGGATGAAGATTATGCCCGTGCTTCAGGCGAACATATTCGACGAAGGCCAATGTAATGATCAAGCACGAGAGGCCATTCGGCTCACCTTTCATGATGGGGTGGGC
AGGTCTACCATCCTTGAAAAAGCCGGCGCATTTTC
AGGCGGCGGTGCGGACGGAAGCATCATTCGCTTTGCAGAGACCGAGCTAGCTAATCCTGCGAACGATGGCCTAGAAAACATCGTC
CTATCTCTCCAAGACGTCGCCGACAACCACAACGTCTCGTATGGCGATAT
AATACAGTTCGCTGGTGCAGTCGGCCTCTCCAACTGCCCAGGGAGCCCCCGCCTCCCGTTCTACGCCGGA
CGGCCTAACGCCGTCGCACCCTCGCCGCCCGGTCTCGTTCCCTCCCCAACCGACGACGCCGACACCATATTGGCGCGTATGTCCGACGCAGGATTCACCGCAGAAGACACGGTAGCCCTT
CTTGCCGCACACTCAGTCGCAAGGCAGAAGACGGTTGACCCCAGTGTACCGAACGTGCCGTTCGACAGCACGCCCGGGGCGTTCGACACGAAATTTTACGCAGAG
ATGTTGCTCAAGGGC
ATGGGCTACCCTGGCAAGGGCGGGAACTCCGCTGAGGTGAAGTCCGCGTCCAAGCATGTCATGCGCCTTGCCTCCGACGCGGCACTCGCCCAACACCCGATTACATCCGCCCTCTGGCGT
TCTTTCGCAG
GCGATCACAACGCTATGCGTGCGGCGTTCCGGGACGCCATGCAGAAGCTCGCAAACCAGGGCCACGCCGGCCTCGTCAACTGTTCCTCCGTCATCCCCCTTCCCGCACCG
CTGCAAGACCGCCCGGGTGTACAGGACAGTATACTTTGA

Retrieve as FASTA