Entry information : ShirCIIBC05
Entry ID 8505
Creation 2011-09-20 (Christophe Dunand)
Last sequence changes 2012-03-28 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2012-10-26 (Nizar Fawal)
Peroxidase information: ShirCIIBC05
Name ShirCIIBC05
Class Other class II peroxidase type C    [Orthogroup: CIIBC001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Stereaceae Stereum
Organism Stereum hirsutum    [TaxId: 40492 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ShirCIIBC05
start..stop
S start..stop
ShirCIIBC04 599 0 1..350 1..355
ShirCIIBC06 578 0 1..350 1..349
ShirCIIBC03 549 0 1..350 1..354
ShirCIIBC02 533 0 1..350 1..357
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 653979..654105 127 N° 2 653856..653920 65 N° 3 653727..653797 71 N° 4 653566..653625 60
N° 5 653160..653442 283 N° 6 652979..653019 41 N° 7 652874..652924 51 N° 8 652737..652816 80
N° 9 652637..652672 36 N° 10 652415..652584 170 N° 11 652289..652357 69  
complement(join(652289..652357,652415..652584,652637..652672,652737..652816,6528 74..652924,652979..653019,653160..653442,653566..653625,653727..653797,653856..6 53920,653979..654105))


exon

Literature and cross-references ShirCIIBC05
DNA ref. JGI genome:   scaffold_17 (654105..652289)
Cluster/Prediction ref. JGI gene:   7824
Protein sequence: ShirCIIBC05
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   350 (328)
PWM (Da):   %s   37042.44 (34785.2)  
PI (pH):   %s   4.2 (4.26) Peptide Signal:   %s   cut: 23 range:23-350
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDFSQLLSLVALALVASQVAEAAPPPKVTCADGNVTANAVCCQLFSAVAILQENLFDGAQCGEAHSALRLSFHDAIGFSIHGMQGLSGGGADGSILVFNATELKFRRIDDITSEQFPVFQTTNLSAGDFVHLAAAVGTANCPGAPQLDFFFGRAPPVAPAPDLTVPEPTDSVDAIIERFADAGFSVDEIVALLSSHTVAATIPGTPFDTTPFTFDTQFFVETLLKGSLFPGNGSQAGEVLSPIHGEMRLQSDFELSDPRTACLWQAMINDQTRMQTQFKAAMHKLELLGQPDTLVDCSDVIPVPAPFKGQAVFPATFSRRDIQQCLLEPFPTLQTLPGPETSVPPV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATTTCTCGCAGCTTCTCTCCCTCGTGGCCCTCGCCCTCGTTGCCAGCCAGGTAGCCGAGGCTGCTCCTCCGCCGAAGGTTACCTGTGCTGACGGTAACGTAACCGCCAACGCTGTC
TGCTGTC
GTCAGTCATCCCCGTCCTTTCATGGCTCAGTATACCTGTGCTGACGCTTTCGTCAAAGAGCTGTTCTCTGCGGTAGCCATCCTCCAGGAGAACTTGTTCGATGGCGCACAGTG
TGGTGAAGAG
GTGTTTTGAATTATAGCTTGAGGTCGACGTACGGTCACTGATCGGTTCAATTTATTAGGCACACTCTGCTCTTCGTCTTAGTTTCCACGACGCAATCGGGTTCTCAATCC
ACGGTATGCAAGGTCTCTC
GTTTCGTAGTGCAAATCACTGACTAAGATATTGTTTCTAGGCGGAAAGTATGTGATTCATCGATTTTCTATCCCTCGCTAAATACTAACTTTTTTCTGAAG

GGGTGGAGGAGCTGACGGTTCCATCTTGGTGTTCAATGCCACTGAACTGAAATTCCGTAG
GTCATGAACCATCTCTTCGTTTTTGCTCAAATTTTCCTGACAGACATATCTCACAGACGC
TAATATCGGGTAAGGCGCACCCTTTGGGGAAGAGACAAGCGAGTACTGAAATATCAGCCGCAGGATTGACGACATTACCTCCGAGCAGTTCCCGGTGTTCCAGACTACAAATTTATCCGC
TGGTGACTTCGTCCACTTGGCTGCGGCTGTGGGCACGGCCAACTGCCCAGGTGCTCCCCAGCTCGACTTTTTCTTTGGACGCGCCCCGCCCGTTGCCCCTGCCCCCGACCTGACTGTTCC
AGAGCCTACTGACTCCGTCGATGCTATCATTGAGAGATTTGCGGATGCCGGCTTCAGCGTTGACGAGATCGTCGCTCTACTGTCGTCTCACACCGTTGCTGCAGCA
GTAAGTCCCTTCCT
AATCACTCATCCCTTGAACCCAGAGTTGATGGCTGATATTTCTTTAGGACGAAATCGACACGGTACGAGTTCGAAAGATATGAATGCGGACTCGGGTCTATGAACTGATACGCTGTCATA
AACCAGACCATTCCTGGAACTCCCTTCGACACGACCCCCTTTACCTTGTGAGCCACTTCATGAATCTCAGGTCATCTCGATACTTACGTAGACTATTTTAGCGACACTCAGTTCTTCGTC
GAGACGTTGTTGAAAGGATCGTTATTCCCCGG
GTATATCAGTCTCTGCATCTAGGTCAGGGACACTGTCTAATATCATACTTCGTCCAGTAACGGCTCTCAGGCCGGCGAGGTTTTGTCA
CCCATTCATGGAGAGATGCGTCTCCAGTCCGATTTCGAGCTCTCGCGCG
GTGAGTCTGTGACAGCTGAATGCTCAGTTCCTCAGTCATCAGTGTCTGACCAGCGTAATCCTAGACCCTCG
AACTGCTTGCTTGTGGCAAGCCATGATCA
GTGTGTAGTTCCTCTTCTCTACTTTTCCGGCCTAGTCTGACGGAACATGCAGACGACCAGACCCGCATGCAGACTCAATTCAAGGCTGCGA
TGCATAAACTCGAGCTCCTCGGACAACCCGACACCCTCGTTGACTGTTCCGATGTTATTCCTGTCCCCGCCCCCTTCAAGGGACAGGCTGTTTTCCCCGCCACGTTCAGTCGACGTGACA
TCCAGCAAGCT
GTATGTTCCCTCTACTAGTTCATGGCTAAGCAGAGCGCTGACTGTAGGCTTGTCCAGTGCCTTCTCGAGCCGTTCCCCACTCTCCAGACTCTTCCCGGTCCCGAGACCT
CCGTCCCTCCTGTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATTTCTCGCAGCTTCTCTCCCTCGTGGCCCTCGCCCTCGTTGCCAGCCAGGTAGCCGAGGCTGCTCCTCCGCCGAAGGTTACCTGTGCTGACGGTAACGTAACCGCCAACGCTGTC
TGCTGTC
AGCTGTTCTCTGCGGTAGCCATCCTCCAGGAGAACTTGTTCGATGGCGCACAGTGTGGTGAAGAGGCACACTCTGCTCTTCGTCTTAGTTTCCACGACGCAATCGGGTTCTCA
ATCCACGGTATGCAAGGTCTCTC
GGGTGGAGGAGCTGACGGTTCCATCTTGGTGTTCAATGCCACTGAACTGAAATTCCGTAGGATTGACGACATTACCTCCGAGCAGTTCCCGGTGTTC
CAGACTACAAATTTATCCGCTGGTGACTTCGTCCACTTGGCTGCGGCTGTGGGCACGGCCAACTGCCCAGGTGCTCCCCAGCTCGACTTTTTCTTTGGACGCGCCCCGCCCGTTGCCCCT
GCCCCCGACCTGACTGTTCCAGAGCCTACTGACTCCGTCGATGCTATCATTGAGAGATTTGCGGATGCCGGCTTCAGCGTTGACGAGATCGTCGCTCTACTGTCGTCTCACACCGTTGCT
GCAGCA
ACCATTCCTGGAACTCCCTTCGACACGACCCCCTTTACCTTCGACACTCAGTTCTTCGTCGAGACGTTGTTGAAAGGATCGTTATTCCCCGGTAACGGCTCTCAGGCCGGCGAG
GTTTTGTCACCCATTCATGGAGAGATGCGTCTCCAGTCCGATTTCGAGCTCTCGCGCG
ACCCTCGAACTGCTTGCTTGTGGCAAGCCATGATCAACGACCAGACCCGCATGCAGACTCAA
TTCAAGGCTGCGATGCATAAACTCGAGCTCCTCGGACAACCCGACACCCTCGTTGACTGTTCCGATGTTATTCCTGTCCCCGCCCCCTTCAAGGGACAGGCTGTTTTCCCCGCCACGTTC
AGTCGACGTGACATCCAGCAAGCT
TGCCTTCTCGAGCCGTTCCCCACTCTCCAGACTCTTCCCGGTCCCGAGACCTCCGTCCCTCCTGTGTAA

Retrieve as FASTA