Entry information : ShirCIIBC06
Entry ID 8506
Creation 2011-09-20 (Christophe Dunand)
Last sequence changes 2011-09-20 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2012-10-26 (Nizar Fawal)
Peroxidase information: ShirCIIBC06
Name ShirCIIBC06
Class Other class II peroxidase type C    [Orthogroup: CIIBC001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Stereaceae Stereum
Organism Stereum hirsutum    [TaxId: 40492 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ShirCIIBC06
start..stop
S start..stop
ShirCIIBC04 593 0 1..352 1..358
ShirCIIBC05 563 0 1..349 1..350
ShirCIIBC03 548 0 1..352 1..357
ShirCIIBC02 534 0 1..352 1..360
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 617766..617892 127 N° 2 617945..618009 65 N° 3 618077..618135 59 N° 4 618251..618306 56
N° 5 618416..618616 201 N° 6 618681..618726 46 N° 7 618786..618834 49 N° 8 618966..619006 41
N° 9 619063..619113 51 N° 10 619164..619279 116 N° 11 619331..619422 92 N° 12 619481..619558 78
N° 13 619616..619680 65 N° 14 619738..619750 13  
join(617766..617892,617945..618009,618077..618135,618251..618306,618416..618616, 618681..618726,618786..618834,618966..619006,619063..619113,619164..619279,61933 1..619422,619481..619558,619616..619680,619738..619750)


exon

Literature and cross-references ShirCIIBC06
DNA ref. JGI genome:   scaffold_17 (617766..619750)
Cluster/Prediction ref. JGI gene:   7801
Protein sequence: ShirCIIBC06
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   352 (330)
PWM (Da):   %s   36760.19 (34664.0)  
PI (pH):   %s   4.18 (4.14) Peptide Signal:   %s   cut: 23 range:23-352
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFAQLSAIVALALGAAQVAKAAPPPKVTCADGNVTANAVCCQLFPVVANLQQNLFDGAQCGEAHSALRLSFHDAIGFSLTRKGGGADGSILVFNATEEAHHHSRIDEITADQFPVFQTTNLSAGDFVHLAAAVGTANCPGAPQLDFFFGRAPPLGPAADLTVPEPTDNVTAILARFADAGFAPDEVVALLSSHTVAATIPGTPFDTTPFTFDTQFFVETLLVGTLFPGNGSQAGEVLSPIPGEMRLFSDSVLARDPRTACMWQEMNDQTRMQTLFKAAMHKLELLGQPDTLVDCSVVPVPAPFTGSAVFPATFNMSDIQQACDTVPFPTLETLPGPETSVPPVPGS

Retrieve as FASTA  
Remarks Complete sequence from genomic (13 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCGCTCAGCTCTCTGCCATCGTCGCTCTCGCTCTCGGCGCCGCTCAGGTCGCCAAGGCTGCACCCCCGCCGAAGGTTACCTGCGCTGACGGAAACGTCACCGCAAACGCCGTC
TGCTGCC
GTTAGTTGCCCTTCCTACGGCGTTCTACTCCTCGACTGACGACCTTGTTTAGAGCTCTTCCCTGTTGTGGCTAACCTTCAGCAGAATTTGTTCGACGGTGCTCAATGCGGTGA
AGAG
GTTTGTGTCATTTTTCTTCTTGGATCTGCCTTGAAATTTACTGTTTACTGTTTTTTTTTGGTGTTAGGCCCACTCTGCTCTTCGTCTGTCGTTCCACGACGCTATTGGATTTTCCC
TCACCCGTAA
GCACCGTTTTTCTCCCAGAGCAAGCCTAGTCTGTTGCTGACCGTACCAACAGGCGATGTGTTAGTTCTGCTTAAAGGCATCTTCACTGAGGCTGCTAATCGAATTGTATT
ACCAGGGGTGGAGGAGCTGACGGTTCTATTTTGGTCTTTAACGCCACTGAAGAGGCATTTCGTAAGCATCGGTATCCACACTTCATGTAAGCACGTACTGATGAACATCCTGTAGACGCC
AACATTGGGTGAGTCGGTATTATGGAGCCTTGCACTGTGTACTAACCGAGACCATCACTCCAGGATCGACGAGATCACCGCCGATCAATTCCCTGTCTTCCAGACCACTAATCTCTCTGC
TGGAGACTTCGTCCATTTGGCGGCTGCTGTCGGCACGGCGAACTGCCCAGGTGCTCCTCAGTTGGACTTCTTCTTCGGTCGGGCCCCTCCCTTGGGCCCCGCTGCTGATTTGACCGTTCC
GGAGCCTACTG
GTAAGCTTTTATTTCGGAATGCGCGTGGAGCCAAAAGACTGACTCAGTTGGGCTTCGTCTCCAGACAACGTCACCGCCATCTTGGCTAGGTTCGCCGATGCCGGGTTTG
C
GTATGTGCACATCCCTTGAGTAGGTTTGGTGGACTAGAAGCTCACTAACCCTTTGATAGCCCCGACGAGGTTGTTGCACTCCTGTCTTCCCACACCGTGGCGGCTGCGGTATGCAACAG
TATTTTCTATGTACGCCATTTCAAGGGCTGACATGATGTGCGCTGTAGGACGAGATCGACACGGTAGGTAGTTGATCACTACGAATTACAGGCACCTGCTCACATTTTCTTGTAAATTAG

ACTATCCCAGGAACTCCGTTTGACACGACGCCTTTCACCTT
GTGAGCAATGCTTTTATATGACACAGAAACCGCCCGTAACAAGATGTAATTCATAGCGACACTCAGTTCTTCGTTGAGA
CCTTGCTGGTCGGCACATTGTTCCCTGG
GTACGTATCCTCCTCACGGTAAGGATGCGACTCCTAACATGTTTTTGTAGCAACGGCTCGCAAGCTGGTGAAGTGCTGTCGCCCATCCCCGG
AGAGATGCGTCTTTTTAGTGACTCCGTTCTCGCTCGTGACCCACGGACGGCCTGCATGTGGCAGGAGATGATCA
GTAAGCCTCCGAAACCTTCGCAATGCGTACCACCTCTGACATAAGC
TATAGACGACCAGACTCGCATGCAGACCCTTTTCAAGGCTGCTATGCACAAGCTTGAGCTTCTTGGTCAGCCCGACACCCTCGTCGACTGCTCCGATGTTCGTTTATATTTCCATATGAT
CGCTTCTGTTCTCTTGACCATAACTCGCTCTCTAGGTTGTTCCTGTTCCCGCCCCATTCACTGGTTCTGCCGTCTTCCCCGCCACTTTCAACATGAGTGACATCCAGCAAGCTGTCAGTT
CTTCAGCCTATCTAACTCCATGAAATCATGCTCATCAAGCTGTTTTACAGTGCGATACCGTGCCGTTCCCGACCCTCGAGACCCTCCCTGGCCCCGAGACCTCAGTCCCGCCCGTGTAAG
CACGTCCGTCTGTATTCGTTATTGCACTGTCTGATCGCAGTTTTGTCGATAGTCCCGGCTCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCGCTCAGCTCTCTGCCATCGTCGCTCTCGCTCTCGGCGCCGCTCAGGTCGCCAAGGCTGCACCCCCGCCGAAGGTTACCTGCGCTGACGGAAACGTCACCGCAAACGCCGTC
TGCTGCC
AGCTCTTCCCTGTTGTGGCTAACCTTCAGCAGAATTTGTTCGACGGTGCTCAATGCGGTGAAGAGGCCCACTCTGCTCTTCGTCTGTCGTTCCACGACGCTATTGGATTTTCC
CTCACCCGTAA
GGGTGGAGGAGCTGACGGTTCTATTTTGGTCTTTAACGCCACTGAAGAGGCATTTCACCATCACTCCAGGATCGACGAGATCACCGCCGATCAATTCCCTGTCTTCCAG
ACCACTAATCTCTCTGCTGGAGACTTCGTCCATTTGGCGGCTGCTGTCGGCACGGCGAACTGCCCAGGTGCTCCTCAGTTGGACTTCTTCTTCGGTCGGGCCCCTCCCTTGGGCCCCGCT
GCTGATTTGACCGTTCCGGAGCCTACTG
ACAACGTCACCGCCATCTTGGCTAGGTTCGCCGATGCCGGGTTTGCCCCCGACGAGGTTGTTGCACTCCTGTCTTCCCACACCGTGGCGGCT
GCG
ACTATCCCAGGAACTCCGTTTGACACGACGCCTTTCACCTTCGACACTCAGTTCTTCGTTGAGACCTTGCTGGTCGGCACATTGTTCCCTGGCAACGGCTCGCAAGCTGGTGAAGTG
CTGTCGCCCATCCCCGGAGAGATGCGTCTTTTTAGTGACTCCGTTCTCGCTCGTGACCCACGGACGGCCTGCATGTGGCAGGAGATGATCA
ACGACCAGACTCGCATGCAGACCCTTTTC
AAGGCTGCTATGCACAAGCTTGAGCTTCTTGGTCAGCCCGACACCCTCGTCGACTGCTCCGAT
GTTGTTCCTGTTCCCGCCCCATTCACTGGTTCTGCCGTCTTCCCCGCCACTTTCAAC
ATGAGTGACATCCAGCAAGCT
TGCGATACCGTGCCGTTCCCGACCCTCGAGACCCTCCCTGGCCCCGAGACCTCAGTCCCGCCCGTTCCCGGCTCTTAG

Retrieve as FASTA