Entry information : DsCIIBA04 (MnP7)
Entry ID 8510
Creation 2011-09-21 (Christophe Dunand)
Last sequence changes 2011-09-21 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2012-09-27 (Nizar Fawal)
Peroxidase information: DsCIIBA04 (MnP7)
Name (synonym) DsCIIBA04 (MnP7)
Class Other class II peroxidase type A    [Orthogroup: CIIBA001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Polyporaceae Dichomitus
Organism Dichomitus squalens    [TaxId: 114155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value DsCIIBA04
start..stop
S start..stop
ParcCIIBA06 587 0 1..361 1..361
GsppCIIBA09 581 0 1..361 1..361
GsppCIIBA08 581 0 1..361 1..361
ParcCIIBA04 564 0 26..358 29..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 35276..35383 108 N° 2 35177..35220 44 N° 3 35080..35125 46 N° 4 34968..35026 59
N° 5 34860..34915 56 N° 6 34729..34807 79 N° 7 34227..34666 440 N° 8 33983..34158 176
N° 9 33862..33926 65 N° 10 33784..33796 13  
complement(join(33784..33796,33862..33926,33983..34158,34227..34666,34729..34807 ,34860..34915,34968..35026,35080..35125,35177..35220,35276..35383))


exon

Literature and cross-references DsCIIBA04 (MnP7)
DNA ref. JGI genome:   scaffold_87 (35383..33784)
Protein sequence: DsCIIBA04 (MnP7)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   361 (343)
PWM (Da):   %s   37548.77 (35765.7)  
PI (pH):   %s   4.72 (4.58) Peptide Signal:   %s   cut: 19 range:19-361
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFAKTILALAALAVAVKAVPSHSAVCSQGRRASSEACCVWFDVLDDIQENLFDGSQCGEETHESLLTFHDAIGLSPALFRQGKFGGGGADGSIMHFADIETNHANGGIDDIVETQRPFAIAHKVSFADFIQFAGAVGVSNCAGGPRLQFLAGRANTTQPSPDLLVPEPSDSTDAIFARFGDAGFSPAEVVALLASHSVAAQDHVDPTIPGTPFDSTPAAFDAQFFVETLLRGTLFPGNGSNVGEVLAPLGGEFRLFSDANIARDARTACEWQSFTDHGSMVRKFEAAMAKLATVGQNPRALTDCSEVIPVPKAVKLPAPTLPAGKTLEDIQACAATPFPALRAAPGPATTVAPVPPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCGCGAAGACCATCCTCGCTCTTGCCGCGCTCGCGGTCGCCGTCAAAGCCGTCCCCTCCCACTCCGCTGTCTGCAGCCAGGGTCGCCGTGCTAGCAGCGAGGCGGTAAGGGCCTGT
ACATCCCTAACCAGGCCAACGGTGTGCTGACCCGATTTGACAGTGCTGTGTCTGGTTCGACGTTCTCGACGACATCCAGGAGAACCTGTACGACACTTACACTCGATGTGGCGGCTCTGC
ATACTGAGAGTCTCACAGGTTCGACGGTTCCCAATGCGGCGAGGAGACTCATGAGTCCCTCCGCGTAAGTAGCGATGCCGGCTCTTTGCTGACTTAGAGCTGACACTGAGTGTCTAGTTG
ACCTTCCACGACGCCATCGGGCTCTCCCCCGCGCTCTTCCGCCAGGGCAAGTTCGG
GTGCGGAGTCTACATATTGTACTGATCGTCGGAACTGACCTCGGACTGACAGCGGTGGAGGCGC
CGATGGCTCCATCATGCACTTCGCGGACATCGAGACCAACTTCC
GTACGTGTCTGCACGGCCCCCGCTCCCGACATCAGCACTGACCACGGGACAGACGCCAACGGCGGCATCGACGACA
TCGTCGAGACCCAGCGCCCCTTCGCCATCGCCCACAAAGTCTCCTTCGCCGACTT
GTGCGTCCCTCCCCGTCTCCGTCCCAGCGCCCCCATACCTGACCACCCCGTCCTCCGCACAGCAT
CCAGTTCGCCGGCGCAGTCGGCGTCTCGAACTGCGCCGGGGGCCCGCGCCTGCAGTTCCTCGCGGGCCGCGCGAACACGACGCAGCCGTCGCCGGACCTGCTCGTGCCCGAGCCGTCCGA
CAGCACGGACGCGATCTTCGCGCGCTTCGGGGACGCGGGCTTCAGTCCCGCCGAGGTCGTCGCGCTGCTCGCGTCGCACTCCGTCGCGGCGCAGGACCACGTGGACCCGACGATCCCGGG
GACGCCGTTCGACTCGACCCCGGCCGCGTTCGACGCGCAGTTCTTTGTGGAGACGCTGTTGAGGGGCACGCTGTTCCCGGGGAACGGGTCGAACGTGGGCGAGGTGCTGGCGCCGCTCGG
GGGCGAGTTTAGGTTGTTCTCGGACGCGAACATTGCGAGGGACGCGCGCACGGCGTGCGAGTGGCAGTCGTTCATCA
GTACGTCGCCCGCGCCGGGCCCAGTGAGTGAGTGAGCAAGGTG
GGCTGACGGCGGCACCGCCCTGCAGCGGACCACGGCTCGATGGTGCGCAAGTTCGAGGCGGCGATGGCGAAGCTCGCGACGGTCGGGCAGAACCCGCGCGCGCTGACCGACTGCTCCGAG
GTGATCCCTGTCCCCAAGGCGGTCAAGCTCCCCGCACCGACCCTGCCAGCGGGCAAGACGCTCGAGGACATCCAGGCTGCG
GTGCGTTTTTCCTGGGGGTGCATGTTACTGCTTGGCTGA
GGATGGTATCGACGTAGTGCGCTGCGACGCCTTTCCCTGCGCTGAGGGCTGCTCCGGGTCCCGCGACCACTGTGGCTCCTGTGTATGTTGTTCAGCGTGGTTTGTGCGGTGTGAGATGGA
TACTAACCGATAGCGATACTTGTGCAGTCCGCCGTCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCGCGAAGACCATCCTCGCTCTTGCCGCGCTCGCGGTCGCCGTCAAAGCCGTCCCCTCCCACTCCGCTGTCTGCAGCCAGGGTCGCCGTGCTAGCAGCGAGGCGTGCTGTGTCTGG
TTCGACGTTCTCGACGACATCCAGGAGAACCT
GTTCGACGGTTCCCAATGCGGCGAGGAGACTCATGAGTCCCTCCGCTTGACCTTCCACGACGCCATCGGGCTCTCCCCCGCGCTCTTC
CGCCAGGGCAAGTTCGG
CGGTGGAGGCGCCGATGGCTCCATCATGCACTTCGCGGACATCGAGACCAACTTCCACGCCAACGGCGGCATCGACGACATCGTCGAGACCCAGCGCCCCTTC
GCCATCGCCCACAAAGTCTCCTTCGCCGACTT
CATCCAGTTCGCCGGCGCAGTCGGCGTCTCGAACTGCGCCGGGGGCCCGCGCCTGCAGTTCCTCGCGGGCCGCGCGAACACGACGCAG
CCGTCGCCGGACCTGCTCGTGCCCGAGCCGTCCGACAGCACGGACGCGATCTTCGCGCGCTTCGGGGACGCGGGCTTCAGTCCCGCCGAGGTCGTCGCGCTGCTCGCGTCGCACTCCGTC
GCGGCGCAGGACCACGTGGACCCGACGATCCCGGGGACGCCGTTCGACTCGACCCCGGCCGCGTTCGACGCGCAGTTCTTTGTGGAGACGCTGTTGAGGGGCACGCTGTTCCCGGGGAAC
GGGTCGAACGTGGGCGAGGTGCTGGCGCCGCTCGGGGGCGAGTTTAGGTTGTTCTCGGACGCGAACATTGCGAGGGACGCGCGCACGGCGTGCGAGTGGCAGTCGTTCATCA
CGGACCAC
GGCTCGATGGTGCGCAAGTTCGAGGCGGCGATGGCGAAGCTCGCGACGGTCGGGCAGAACCCGCGCGCGCTGACCGACTGCTCCGAGGTGATCCCTGTCCCCAAGGCGGTCAAGCTCCCC
GCACCGACCCTGCCAGCGGGCAAGACGCTCGAGGACATCCAGGCTGCG
TGCGCTGCGACGCCTTTCCCTGCGCTGAGGGCTGCTCCGGGTCCCGCGACCACTGTGGCTCCTGTTCCGCCG
TCCTAA

Retrieve as FASTA