Entry information : DsCIIBB07 (MnP6)
Entry ID 8513
Creation 2011-09-21 (Christophe Dunand)
Last sequence changes 2011-09-21 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2012-10-29 (Nizar Fawal)
Peroxidase information: DsCIIBB07 (MnP6)
Name (synonym) DsCIIBB07 (MnP6)
Class Other class II peroxidase type B    [Orthogroup: CIIBB001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Polyporaceae Dichomitus
Organism Dichomitus squalens    [TaxId: 114155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value DsCIIBB07
start..stop
S start..stop
DsCIIBB08 647 0 1..366 1..366
ParcCIIBB02 601 0 1..366 1..364
ParcCIIBB08 600 0 1..363 1..361
GsppCIIBB03 571 0 1..366 1..362
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 224416..224470 55 N° 2 224148..224352 205 N° 3 223272..224099 828 N° 4 223202..223214 13
complement(join(223202..223214,223272..224099,224148..224352,224416..224470))


exon

Literature and cross-references DsCIIBB07 (MnP6)
DNA ref. JGI genome:   scaffold_11 (224470..223202)
Protein sequence: DsCIIBB07 (MnP6)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   366 (347)
PWM (Da):   %s   38207.96 (36176.8)  
PI (pH):   %s   4.08 (4.01) Peptide Signal:   %s   cut: 20 range:20-366
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVFKALLISVLAAFQITKGALIRRATCSDGTVVANSACCVLIPVIQDIQENLFDGGECGEEVHESLRLTFHDAIGISPAIAATGVFGGGGADGSIILFEDIEPNFHANNGVDEIIDEQKPIIAKHNITTADFIQLAGAIGVSNCPGAPQLNVFIGRPDATQPAPDKTVPEPFDSVDSILARFQDAFSDVGGFTPAEVVALLASHTIAAADHVDPSIPGTPFDSTPELFDTQFFIETQLRGTLFPGTGGNQGEAQSALAGELRLQSDSELARDSRTACEWQSFVNNQAKLQSAFKAAFRRMSILGHDESSLIDCSDVVPVPPAPASDAHFPAGQTIDDVEQACASTPFPTLPTDPGPASSVAPVPPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCTTCAAAGCCCTCCTCATCTCTGTCCTCGCTGCATTTCAGATCACTAAAGGTGAGTTAACGGGTTACTGGTGCGGTTTGACTATGGCTTACTGACCCACTCGTCTCGCAATAGGC
GCCCTCATTCGTCGTGCCACCTGCTCCGACGGCACAGTAGTGGCCAACAGCGCGTGCTGCGTTCTGATTCCGGTCATTCAGGACATTCAGGAGAACCTCTTCGACGGTGGCGAGTGCGGG
GAGGAGGTGCACGAGTCCCTTCGTCTCACCTTCCATGATGCAATCGGTATTTCTCCCGCCATTGCCGCAACGGGCGTTTTCGG
GTCGGTACTCCCTCAATGAGCACACAAACCATTCTGA
CCAATACACAGAGGTGGAGGCGCCGACGGTTCAATAATCCTCTTCGAGGACATCGAGCCCAACTTCCACGCCAACAACGGTGTCGACGAGATCATTGACGAGCAAAAGCCTATCATCGCG
AAGCACAACATTACGACCGCGGACTTCATCCAGTTGGCGGGTGCGATCGGCGTCTCGAACTGCCCTGGTGCTCCTCAACTAAATGTCTTCATCGGCCGTCCCGATGCGACGCAGCCTGCG
CCGGACAAGACCGTCCCCGAGCCATTCGATTCTGTCGACAGCATCCTCGCCCGTTTCCAAGACGCGTTCTCCGACGTCGGCGGCTTCACTCCTGCTGAGGTTGTTGCGCTCCTGGCCTCC
CACACCATCGCTGCCGCCGACCACGTCGACCCTAGCATCCCCGGCACACCCTTCGACTCGACCCCCGAGCTTTTTGACACCCAGTTTTTCATCGAGACCCAGCTTCGCGGCACGTTGTTC
CCCGGCACAGGGGGCAACCAGGGTGAGGCCCAGTCCGCACTCGCGGGGGAGCTCCGCCTCCAGTCCGACTCAGAGCTCGCGCGCGACTCGCGTACGGCGTGCGAGTGGCAGTCGTTCGTG
AACAACCAGGCGAAGCTCCAATCTGCGTTTAAGGCCGCTTTCCGCAGGATGTCCATCCTCGGCCACGACGAGAGCTCGCTCATCGACTGCTCCGATGTCGTCCCCGTGCCTCCTGCGCCC
GCTTCTGATGCGCACTTCCCCGCCGGGCAGACCATCGACGATGTCGAGCAGGCGTGCGCCTCTACTCCGTTCCCCACTCTCCCCACCGACCCTGGCCCAGCTAGCTCTGTCGCCCCTGT
G
TGAGTGTTCTGACCCTGACAGGCTTGGATGTCTAGAAGCTGACTTACTGCATACAGTCCCCCTTCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCTTCAAAGCCCTCCTCATCTCTGTCCTCGCTGCATTTCAGATCACTAAAGGCGCCCTCATTCGTCGTGCCACCTGCTCCGACGGCACAGTAGTGGCCAACAGCGCGTGCTGCGTT
CTGATTCCGGTCATTCAGGACATTCAGGAGAACCTCTTCGACGGTGGCGAGTGCGGGGAGGAGGTGCACGAGTCCCTTCGTCTCACCTTCCATGATGCAATCGGTATTTCTCCCGCCATT
GCCGCAACGGGCGTTTTCGG
AGGTGGAGGCGCCGACGGTTCAATAATCCTCTTCGAGGACATCGAGCCCAACTTCCACGCCAACAACGGTGTCGACGAGATCATTGACGAGCAAAAGCCT
ATCATCGCGAAGCACAACATTACGACCGCGGACTTCATCCAGTTGGCGGGTGCGATCGGCGTCTCGAACTGCCCTGGTGCTCCTCAACTAAATGTCTTCATCGGCCGTCCCGATGCGACG
CAGCCTGCGCCGGACAAGACCGTCCCCGAGCCATTCGATTCTGTCGACAGCATCCTCGCCCGTTTCCAAGACGCGTTCTCCGACGTCGGCGGCTTCACTCCTGCTGAGGTTGTTGCGCTC
CTGGCCTCCCACACCATCGCTGCCGCCGACCACGTCGACCCTAGCATCCCCGGCACACCCTTCGACTCGACCCCCGAGCTTTTTGACACCCAGTTTTTCATCGAGACCCAGCTTCGCGGC
ACGTTGTTCCCCGGCACAGGGGGCAACCAGGGTGAGGCCCAGTCCGCACTCGCGGGGGAGCTCCGCCTCCAGTCCGACTCAGAGCTCGCGCGCGACTCGCGTACGGCGTGCGAGTGGCAG
TCGTTCGTGAACAACCAGGCGAAGCTCCAATCTGCGTTTAAGGCCGCTTTCCGCAGGATGTCCATCCTCGGCCACGACGAGAGCTCGCTCATCGACTGCTCCGATGTCGTCCCCGTGCCT
CCTGCGCCCGCTTCTGATGCGCACTTCCCCGCCGGGCAGACCATCGACGATGTCGAGCAGGCGTGCGCCTCTACTCCGTTCCCCACTCTCCCCACCGACCCTGGCCCAGCTAGCTCTGTC
GCCCCTGT
TCCCCCTTCCTAA

Retrieve as FASTA