Entry information : DsCIIBB08 (MnP5)
Entry ID 8514
Creation 2011-09-21 (Christophe Dunand)
Last sequence changes 2012-10-31 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-10-31 (Christophe Dunand)
Peroxidase information: DsCIIBB08 (MnP5)
Name (synonym) DsCIIBB08 (MnP5)
Class Other class II peroxidase type B    [Orthogroup: CIIBB001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Polyporaceae Dichomitus
Organism Dichomitus squalens    [TaxId: 114155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value DsCIIBB08
start..stop
S start..stop
DsCIIBB07 648 0 1..366 1..366
ParcCIIBB02 623 0 1..366 1..364
ParcCIIBB08 619 0 1..363 1..361
GsppCIIBB03 592 0 1..366 1..362
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 935465..935519 55 N° 2 935583..935787 205 N° 3 935840..936667 828 N° 4 936725..936737 13
join(935465..935519,935583..935787,935840..936667,936725..936737)


exon

Literature and cross-references DsCIIBB08 (MnP5)
DNA ref. JGI genome:   scaffold_3 (935465..936731)
Cluster/Prediction ref. JGI gene:   50355
Protein sequence: DsCIIBB08 (MnP5)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   367 (347)
PWM (Da):   %s   38131.98 (36117.9)  
PI (pH):   %s   4.17 (4.13) Peptide Signal:   %s   cut: 20 range:20-366
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKTLLVSVLAALQVANGALIRRATCSDGTVVSDSACCALIPVIQDLQENLFDGGECGEEVHESLRLTFHDAIGISPAIAATGVFGGGGADGSIALFDDIETNFHANNGVDEIIGEQKPLIAKHNITTADFIQLAGAIGVSNCPGAPQLNVFIGRPDATQPAPDKTVPEPFDTVDSILARFQDAFSTVGGFTPAEVVALLASHTIAAADHVDPSIPGTPFDSTPELFDTQFFIETQIRGTIFPGTGGNQGEVESPLHGELRLQSDSELARDSRTACEWQSFVGNQAKLQSAFKAAFRRMSVLGHDESALIDCSELVPVPPAPASVAHLPAGVTHNDIEQACASTPFPTLPTDPGPVTSVAPVPPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Incorrect prediction from JGI (last exon is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAAACCCTCCTCGTATCTGTTCTCGCCGCGCTCCAGGTCGCCAATGGTGAGCTGACGAATTGTTCAGACCGCTTGGGCCGAGGTTATTTACCCATTGTCCTTGTATCAGGC
GCGCTCATTCGTCGTGCAACCTGCTCGGACGGCACCGTAGTCTCTGACAGTGCTTGCTGTGCATTGATCCCAGTTATTCAGGACCTTCAGGAGAACCTATTCGACGGTGGCGAGTGCGGC
GAGGAGGTCCACGAGTCCCTCCGTCTCACCTTCCACGATGCCATTGGTATATCGCCCGCCATCGCCGCCACGGGCGTGTTCGG
GTCAGTGCTTTCTGTTACAGTGTCCTTTGGAAGAATT
CTGACGACCGCACAGAGGTGGAGGCGCTGACGGTTCGATTGCCCTCTTCGACGACATCGAGACCAACTTCCACGCCAACAACGGTGTCGACGAGATCATCGGCGAGCAAAAGCCTCTCAT
CGCGAAGCACAACATCACCACCGCCGACTTCATCCAATTGGCGGGTGCGATCGGTGTCTCGAACTGCCCCGGCGCTCCTCAACTGAACGTCTTCATCGGCCGTCCCGACGCGACCCAGCC
TGCGCCTGACAAGACCGTCCCGGAGCCGTTCGACACCGTCGACAGCATCCTCGCCCGCTTCCAGGACGCCTTCTCGACAGTCGGCGGCTTCACCCCCGCCGAAGTCGTCGCCCTTCTCGC
GTCCCACACCATCGCCGCCGCCGACCACGTCGACCCGTCCATCCCCGGCACGCCCTTCGACTCCACCCCCGAGCTCTTCGACACCCAGTTCTTCATCGAGACCCAGATCCGCGGCACGAT
CTTCCCCGGCACGGGGGGCAACCAAGGCGAGGTCGAGTCCCCGCTGCACGGCGAGCTGCGCCTGCAGTCGGACTCGGAGCTCGCGCGCGACTCGCGCACCGCGTGCGAGTGGCAGTCGTT
CGTCGGCAACCAGGCGAAGCTCCAGTCCGCGTTCAAGGCCGCCTTCCGCCGGATGTCCGTGCTCGGCCACGACGAGAGCGCGCTCATCGACTGCTCCGAGCTCGTCCCCGTCCCCCCGGC
CCCCGCCTCCGTCGCGCACCTGCCCGCGGGCGTGACGCACAACGACATCGAGCAGGCGTGCGCCTCCACTCCCTTCCCCACTCTCCCCACTGACCCCGGCCCGGTCACCTCTGTCGCCCC
TGT
GTGAGTGCCTGGTCTTTGACAGGTCTGACGAATCGGACGCTGACGCGGTACACACAGCCCTCCCTCATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAAACCCTCCTCGTATCTGTTCTCGCCGCGCTCCAGGTCGCCAATGGCGCGCTCATTCGTCGTGCAACCTGCTCGGACGGCACCGTAGTCTCTGACAGTGCTTGCTGTGCA
TTGATCCCAGTTATTCAGGACCTTCAGGAGAACCTATTCGACGGTGGCGAGTGCGGCGAGGAGGTCCACGAGTCCCTCCGTCTCACCTTCCACGATGCCATTGGTATATCGCCCGCCATC
GCCGCCACGGGCGTGTTCGG
AGGTGGAGGCGCTGACGGTTCGATTGCCCTCTTCGACGACATCGAGACCAACTTCCACGCCAACAACGGTGTCGACGAGATCATCGGCGAGCAAAAGCCT
CTCATCGCGAAGCACAACATCACCACCGCCGACTTCATCCAATTGGCGGGTGCGATCGGTGTCTCGAACTGCCCCGGCGCTCCTCAACTGAACGTCTTCATCGGCCGTCCCGACGCGACC
CAGCCTGCGCCTGACAAGACCGTCCCGGAGCCGTTCGACACCGTCGACAGCATCCTCGCCCGCTTCCAGGACGCCTTCTCGACAGTCGGCGGCTTCACCCCCGCCGAAGTCGTCGCCCTT
CTCGCGTCCCACACCATCGCCGCCGCCGACCACGTCGACCCGTCCATCCCCGGCACGCCCTTCGACTCCACCCCCGAGCTCTTCGACACCCAGTTCTTCATCGAGACCCAGATCCGCGGC
ACGATCTTCCCCGGCACGGGGGGCAACCAAGGCGAGGTCGAGTCCCCGCTGCACGGCGAGCTGCGCCTGCAGTCGGACTCGGAGCTCGCGCGCGACTCGCGCACCGCGTGCGAGTGGCAG
TCGTTCGTCGGCAACCAGGCGAAGCTCCAGTCCGCGTTCAAGGCCGCCTTCCGCCGGATGTCCGTGCTCGGCCACGACGAGAGCGCGCTCATCGACTGCTCCGAGCTCGTCCCCGTCCCC
CCGGCCCCCGCCTCCGTCGCGCACCTGCCCGCGGGCGTGACGCACAACGACATCGAGCAGGCGTGCGCCTCCACTCCCTTCCCCACTCTCCCCACTGACCCCGGCCCGGTCACCTCTGTC
GCCCCTGT
CCCTCCCTCATAA

Retrieve as FASTA