Entry information : SbPrx69 (Sobic.003G437400.1 [2.1] / Sb03g046810 [1.4])
Entry ID 853
Creation 2007-09-11 (Christophe Dunand)
Last sequence changes 2011-01-24 (Toky Ramarohetra)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx69 (Sobic.003G437400.1 [2.1] / Sb03g046810 [1.4])
Name (synonym) SbPrx69 (Sobic.003G437400.1 [2.1] / Sb03g046810 [1.4])
Class Class III peroxidase    [Orthogroup: Prx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Callus
Cell culture
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx69
start..stop
S start..stop
ZmPrx139 602 0 20..359 22..355
SiPrx07 571 0 30..359 30..354
PviPrx03 565 0 35..355 30..350
OsPrx23 536 0 13..354 11..355
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 73840891..73841346 456 N° 2 73841464..73842096 633  
join(73840891..73841346,73841464..73842096)


exon

Literature and cross-references SbPrx69 (Sobic.003G437400.1 [2.1] / Sb03g046810 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
Protein ref. UniProtKB:   P84516
DNA ref. Phytozome 12:   chromosome_3 (73840891..73842096)
EST ref. GenBank:   CD226287 [5' end]   CD223442 [3' end]
Cluster/Prediction ref. UniGene:   Sbi.16937
Protein sequence: SbPrx69 (Sobic.003G437400.1 [2.1] / Sb03g046810 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   362 (335)
PWM (Da):   %s   38280.55 (35795.3)  
PI (pH):   %s   8.15 (8.00) Peptide Signal:   %s   cut: 28 range:28-362
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSRAPTLAAAAAVAAVVLICSSSTATAADGNARQPPLAPGLSFDFYKRSCPKAESIVRSFVQDAVRRDVGLAAGLLRLHFHDCFVQGCDASVLLDGSATGPGEQQAPPNLTLRPTAFKAINDIHDRLHKECGGTVVSCSDVLALAARDSVVVSGGPSYKVPLGRRDSASFATQQDVLSGLPPPTAAVPALLAVLSKINLDATDLVALSGGHTIGLGHCTSFEDRLFPRPDPTLNATFAGQLRRTCPAKGTDRRTPLDVRTPNAFDNKYYVNLVNREGLFTSDQDLFSNARTRALVDKFARSQRDFFDQFAFSVVKMGQIKVLTGTQGQIRTNCSARNAAGTTMLPWSVSVVEEAADESLGVF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, intron 2) and 40 ESTs. No overlap between 5' and 3' ends but ESTs compiled in the same Unigene!!
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCGTGCTCCTACGCTCGCTGCCGCTGCCGCGGTGGCGGCCGTCGTCCTCATCTGCTCCTCCTCAACGGCTACCGCGGCGGACGGCAACGCGAGGCAGCCGCCGCTGGCCCCGGGC
CTGTCCTTCGACTTCTACAAGCGCAGCTGCCCTAAGGCGGAGTCCATCGTGCGGAGCTTCGTGCAGGACGCCGTGCGCAGGGACGTCGGCCTCGCCGCCGGCCTCCTCCGCCTCCACTTC
CACGACTGCTTCGTGCAGGGCTGCGACGCCTCCGTGCTCCTCGACGGCTCCGCCACCGGGCCGGGAGAGCAGCAGGCGCCGCCCAACCTCACGCTGCGCCCCACCGCGTTCAAGGCCATC
AACGACATCCACGACCGCCTCCACAAGGAGTGCGGCGGCACCGTCGTCTCCTGCTCCGACGTCCTCGCGCTCGCCGCACGGGACTCCGTCGTCGTG
GTACATACCATACGCATGCATGCA
CAATTTTCTTCTTTTCGTTTCTTTTCTTTAACCTGTTGTTTGCTGCTCGCTCACACACCACCACATGCATGCCTCGATCCATTCCATATGCAGTCCGGCGGGCCGAGCTACAAGGTGCCC
CTGGGTCGTCGCGACAGCGCGAGCTTTGCGACGCAGCAGGACGTCCTGAGCGGGCTCCCGCCGCCGACGGCCGCGGTGCCGGCGCTCCTCGCCGTGCTGTCCAAGATCAACCTGGACGCG
ACGGACCTGGTGGCGCTGTCAGGCGGGCACACCATCGGGCTGGGCCACTGCACGTCGTTCGAGGACCGCCTGTTCCCGCGCCCGGACCCGACGCTGAACGCCACCTTCGCCGGCCAGCTC
CGGCGGACATGCCCGGCGAAGGGCACCGACCGCCGGACGCCGCTGGACGTGCGCACGCCCAACGCGTTCGACAACAAGTACTACGTGAACCTGGTGAACCGTGAGGGGCTCTTCACCTCG
GACCAGGACCTCTTCAGCAACGCCCGCACCAGGGCCCTCGTCGACAAGTTCGCGCGCAGCCAGAGGGACTTCTTCGACCAGTTCGCCTTCTCCGTGGTGAAGATGGGGCAGATCAAGGTG
CTGACGGGCACGCAGGGGCAGATCCGCACCAACTGCTCCGCACGCAACGCCGCCGGGACGACGATGCTGCCGTGGTCCGTCTCCGTCGTCGAGGAGGCTGCAGATGAGAGCCTCGGCGTG
TTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCGTGCTCCTACGCTCGCTGCCGCTGCCGCGGTGGCGGCCGTCGTCCTCATCTGCTCCTCCTCAACGGCTACCGCGGCGGACGGCAACGCGAGGCAGCCGCCGCTGGCCCCGGGC
CTGTCCTTCGACTTCTACAAGCGCAGCTGCCCTAAGGCGGAGTCCATCGTGCGGAGCTTCGTGCAGGACGCCGTGCGCAGGGACGTCGGCCTCGCCGCCGGCCTCCTCCGCCTCCACTTC
CACGACTGCTTCGTGCAGGGCTGCGACGCCTCCGTGCTCCTCGACGGCTCCGCCACCGGGCCGGGAGAGCAGCAGGCGCCGCCCAACCTCACGCTGCGCCCCACCGCGTTCAAGGCCATC
AACGACATCCACGACCGCCTCCACAAGGAGTGCGGCGGCACCGTCGTCTCCTGCTCCGACGTCCTCGCGCTCGCCGCACGGGACTCCGTCGTCGTG
TCCGGCGGGCCGAGCTACAAGGTG
CCCCTGGGTCGTCGCGACAGCGCGAGCTTTGCGACGCAGCAGGACGTCCTGAGCGGGCTCCCGCCGCCGACGGCCGCGGTGCCGGCGCTCCTCGCCGTGCTGTCCAAGATCAACCTGGAC
GCGACGGACCTGGTGGCGCTGTCAGGCGGGCACACCATCGGGCTGGGCCACTGCACGTCGTTCGAGGACCGCCTGTTCCCGCGCCCGGACCCGACGCTGAACGCCACCTTCGCCGGCCAG
CTCCGGCGGACATGCCCGGCGAAGGGCACCGACCGCCGGACGCCGCTGGACGTGCGCACGCCCAACGCGTTCGACAACAAGTACTACGTGAACCTGGTGAACCGTGAGGGGCTCTTCACC
TCGGACCAGGACCTCTTCAGCAACGCCCGCACCAGGGCCCTCGTCGACAAGTTCGCGCGCAGCCAGAGGGACTTCTTCGACCAGTTCGCCTTCTCCGTGGTGAAGATGGGGCAGATCAAG
GTGCTGACGGGCACGCAGGGGCAGATCCGCACCAACTGCTCCGCACGCAACGCCGCCGGGACGACGATGCTGCCGTGGTCCGTCTCCGTCGTCGAGGAGGCTGCAGATGAGAGCCTCGGC
GTGTTCTAG

Retrieve as FASTA