Entry information : TvCIIBA
Entry ID 8530
Creation 2011-09-23 (Christophe Dunand)
Last sequence changes 2012-11-07 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-11-07 (Christophe Dunand)
Peroxidase information: TvCIIBA
Name TvCIIBA
Class Other class II peroxidase type A    [Orthogroup: CIIBA001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Trametes
Organism Trametes versicolor (Coriolus versicolor )    [TaxId: 5325 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TvCIIBA
start..stop
S start..stop
DsCIIBA06 514 0 1..359 1..356
ParcCIIBA02 474 4e-169 23..359 21..360
GsppCIIBA06 463 1e-164 18..359 19..355
ParcCIIBA04 459 3e-163 20..359 21..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 817339..817452 114 N° 2 817230..817279 50 N° 3 817148..817167 20 N° 4 817062..817087 26
N° 5 816960..817006 47 N° 6 816899..816912 14 N° 7 816721..816841 121 N° 8 816425..816656 232
N° 9 816300..816362 63 N° 10 816134..816240 107 N° 11 816042..816079 38 N° 12 815764..815979 216
N° 13 815667..815696 30  
complement(join(815667..815696,815764..815979,816042..816079,816134..816240,8163 00..816362,816425..816656,816721..816841,816899..816912,816960..817006,817062..8 17087,817148..817167,817230..817279,817339..817452))


exon

Literature and cross-references TvCIIBA
DNA ref. JGI genome:   scaffold_12 (817452..815612)
Protein sequence: TvCIIBA
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   360
PWM (Da):   %s   37045.85  
PI (pH):   %s   3.98
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLSKVFFCIATLVLAVTAAPPTSKRATCINGQTASDSKCCVWYDVLDDIQGASGLFQGGQCGEEAHESLRLTFHDAIGISSTAGYVGGGGADGSIMAHSDVELAYAENIGVDDIVELQRPIALRYNVSFGDFIQFAGAVGVSNCLGGPRLQFLAGRSNDSQASPDNLVPGPGDSVDTILARMSDAGFSADEVVALLSSHSVAAQDHLDTTIAGSPLDSTPSVFDAQFFVETLLNGTAFPGNGSNPGEAESPLPGEFRILSDSLIARDSRTSCEWQSYVSDHGRMVTQFEAAMAKMALLGQDASTLVDCSDVIPTPQAAAASVATLPAGKTMDDVEASCAETPFPTLSAASGPETSVAPV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGTCCAAGGTTTTCTTCTGCATCGCGACTCTGGTTCTGGCCGTTACTGCTGCTCCGCCGACATCGAAGCGGGCGACATGCATTAACGGACAGACTGCCAGCGACTCTAAGGTGGGA
TATCCCCTACATATCCTTTATTTGGGCGTGTTCTGACTCGCATCTTTCCGCAGTGCTGCGTTTGGTACGACGTGTTGGATGACATCCAAGGTGCCAGCGGCCTGTGAGTATCTCGAGGGT
CTGGAAAGATAGCATGTGGTATATCTACTAACTGCGTGCTGACAGCTTCCAGGGTGGCCAGTGCGGTCAGTCGCGCCCGTCCTGGTATACCGGTAGATGCCTGAAGCTAATACATGACTT
TACAGGGGAGGAAGCGCATGAATCCCTTCGGGTAAGTCCGCAGATTTACGGAGGGTTCAGCTGCAGTAACACTGTCTGCTTCACAGCTGACCTTCCACGATGCTATTGGGATCTCATCTA
CGGCCGGGTATGT
GTACAACCCCTTTACCCATTCTCAGCTCACTCACCGTTCATTCACAGCGGCGGAGGAGCAGGTATAAGCGGCAACCTTGCCAGTCGATGTCACTCACCATACTAATG
GCGGACCCTAGATGGATCCATCATGGCCCACTCCGACGTCGAGCTTGCCTACGCCGAGAACATCGGAGTAGACGACATCGTCGAGCTGCAGCGGCCGATAGCACTCCGCTACAACGTCTC
CTTTGGGGACTT
GTACGTCGTTTACGAGTCGCTATATGCGCGCATTTAACACCAGAAACTCACTAGTGCTCCACAGTATCCAGTTCGCGGGCGCCGTCGGCGTCAGCAACTGCCTCGGAG
GCCCCCGCCTCCAGTTCCTTGCTGGCCGCTCGAACGACTCGCAGGCCTCGCCCGACAACCTGGTCCCCGGCCCCGGTGACTCTGTCGACACTATCTTGGCGCGCATGTCGGACGCGGGTT
TCTCCGCGGACGAAGTCGTTGCTCTGCTCTCATCGCATAGCGTTGCTGCTCAAGACCATCTGGACACC
GTACGTCTGTGTGAATCAGCGATGTTCCCCCACAAGCTCATGCTGGAACTTG
TACTTGGCAGACTATCGCGGGATCGCCCTTGGACTCCACCCCATCGGTATTTGATGCGCAGTTCTTCGTTGAGGTGAGCACAGGCTACCACAACTAGTATGTGCCGAATGCGTGGTTGAC
GCGATCCGTCAGACCTTGCTGAACGGGACCGCCTTCCCCGGAAACGGCTCCAACCCCGGAGAGGCTGAGTCGCCCCTGCCTGGAGAGTTCCGCATTCTCTCAGACTCTCTGATCGCGCGG
TGCGCACGTCCACTAACTGACGGCCGAGACGAGACACTGACCAGATCCTCCAGGGACTCCCGTACGTCTTGCGAGTGGCAGTCTTACGTCTGTGCGTATTTTGTACCGTTACTCTAATTT
CGTGTCTGTGACTCATTGCACCTGCTCTGCTAGCCGACCACGGACGAATGGTCACCCAGTTCGAAGCTGCGATGGCCAAGATGGCGCTCCTCGGTCAAGACGCCAGCACTCTCGTCGACT
GCTCCGACGTAATCCCCACGCCTCAAGCGGCGGCGGCGAGCGTGGCGACGCTCCCCGCTGGCAAGACGATGGACGACGTTGAGGCCTCCTGCGCGGAGACGCCATTTCCTACGCTGAGTG
CGGCTTCCG
GTGTGTTTTCGATCTTTATATTCGAACAATTCAATGAACGACTTATATCGATATACGTTCGCTCCCAGGTCCTGAGACATCCGTTGCTCCTGTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGTCCAAGGTTTTCTTCTGCATCGCGACTCTGGTTCTGGCCGTTACTGCTGCTCCGCCGACATCGAAGCGGGCGACATGCATTAACGGACAGACTGCCAGCGACTCTAAGTGCTGC
GTTTGGTACGACGTGTTGGATGACATCCAAGGTGCCAGCGGCCT
CTTCCAGGGTGGCCAGTGCGGGGAGGAAGCGCATGAATCCCTTCGGCTGACCTTCCACGATGCTATTGGGATCTCA
TCTACGGCCGGGTATGT
CGGCGGAGGAGCAGATGGATCCATCATGGCCCACTCCGACGTCGAGCTTGCCTACGCCGAGAACATCGGAGTAGACGACATCGTCGAGCTGCAGCGGCCGATA
GCACTCCGCTACAACGTCTCCTTTGGGGACTT
TATCCAGTTCGCGGGCGCCGTCGGCGTCAGCAACTGCCTCGGAGGCCCCCGCCTCCAGTTCCTTGCTGGCCGCTCGAACGACTCGCAG
GCCTCGCCCGACAACCTGGTCCCCGGCCCCGGTGACTCTGTCGACACTATCTTGGCGCGCATGTCGGACGCGGGTTTCTCCGCGGACGAAGTCGTTGCTCTGCTCTCATCGCATAGCGTT
GCTGCTCAAGACCATCTGGACACC
ACTATCGCGGGATCGCCCTTGGACTCCACCCCATCGGTATTTGATGCGCAGTTCTTCGTTGAGACCTTGCTGAACGGGACCGCCTTCCCCGGAAAC
GGCTCCAACCCCGGAGAGGCTGAGTCGCCCCTGCCTGGAGAGTTCCGCATTCTCTCAGACTCTCTGATCGCGCG
GGACTCCCGTACGTCTTGCGAGTGGCAGTCTTACGTCTCCGACCAC
GGACGAATGGTCACCCAGTTCGAAGCTGCGATGGCCAAGATGGCGCTCCTCGGTCAAGACGCCAGCACTCTCGTCGACTGCTCCGACGTAATCCCCACGCCTCAAGCGGCGGCGGCGAGC
GTGGCGACGCTCCCCGCTGGCAAGACGATGGACGACGTTGAGGCCTCCTGCGCGGAGACGCCATTTCCTACGCTGAGTGCGGCTTCCG
GGTCCTGAGACATCCGTTGCTCCTGTGTAA

Retrieve as FASTA