Entry information : TvCIIBB06 (MnP3-short)
Entry ID 8538
Creation 2011-09-23 (Christophe Dunand)
Last sequence changes 2012-12-04 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-12-04 (Christophe Dunand)
Peroxidase information: TvCIIBB06 (MnP3-short)
Name (synonym) TvCIIBB06 (MnP3-short)
Class Other class II peroxidase type B    [Orthogroup: CIIBB001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Trametes
Organism Trametes versicolor (Coriolus versicolor )    [TaxId: 5325 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TvCIIBB06
start..stop
S start..stop
TvCIIBB06_Gangwondo 725 0 1..364 1..364
TvCIIBB09 723 0 1..364 1..364
TvCIIBB10 636 0 9..364 49..404
TvCIIBB05_KN9522 634 0 1..364 1..364
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2217215..2217275 61 N° 2 2217338..2217677 340 N° 3 2217735..2217935 201 N° 4 2217990..2218469 480
N° 5 2218527..2218539 13  
join(2217215..2217275,2217338..2217677,2217735..2217935,2217990..2218469,2218527 ..2218539)


exon

Literature and cross-references TvCIIBB06 (MnP3-short)
DNA ref. JGI genome:   scaffold_10 (2217215..2218539)
Protein sequence: TvCIIBB06 (MnP3-short)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   364
PWM (Da):   %s   38050.19  
PI (pH):   %s   4.53
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKLLGSFVSLLAALQVANGALTRRVTCATGQVTSNAACCALFPVIDDIQTNLFDGGECGEEVHESLRLTFHDAIGISPAIAKTGVFGGGGADGSIAIFADIETNFHANNGVDEIIGEQAPFIARHNLTTADFIQLAGAIGVSNCPGAPRLNVFIGRKDATQPAPDLTVPEPFDDVTKILARFEDAGKFTPAEVVALLASHTIAAADHVDPTIPGTPFDSTPELFDTQFFIETQLKGTLFPGNGSNQGEVESPLGGELRLQSDGLLARDQRTACEWQSFVNNQAKLQSAFKAAFAKMTVLGQNTRALIDCSDVVPTPPAAASKAHFPAGLSHRDIEQACRATPFPTLPTDPGPVTTVAPVPPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns). Incorrect prediction from JGI (last very short exon is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTCAAGCTCCTTGGTTCCTTCGTCTCCCTCCTCGCGGCCCTCCAGGTCGCTAACGGTATGATTTGCCCCTGCTTCTATGGGTACGCCTTCGCTGACATGAGCGACATTTCCTTT
CAGGTGCCCTCACCCGCCGTGTGACGTGCGCCACCGGCCAGGTCACCTCGAACGCGGCCTGCTGCGCGCTCTTCCCCGTCATCGACGACATCCAGACGAACCTGTTCGACGGCGGCGAGT
GCGGTGAGGAGGTCCACGAGTCCCTCCGCCTCACCTTCCACGACGCCATCGGCATCTCGCCCGCCATCGCCAAGACCGGTGTCTTCGGTGGTGGAGGCGCGGACGGCTCCATTGCCATCT
TCGCCGACATCGAGACGAACTTCCACGCCAACAACGGCGTTGACGAGATCATCGGCGAGCAGGCGCCCTTCATCGCCCGCCACAACCTGACCACCGCCGACTT
GTACGTTCTCTCATGCT
GGATTTGATGGCATTATGCATTGCTGACTTCTGGGTGCAGCATCCAGTTGGCCGGTGCCATCGGTGTCTCCAACTGCCCTGGCGCGCCCCGCCTGAACGTCTTCATCGGCCGCAAGGACG
CGACCCAGCCCGCTCCCGACCTGACGGTCCCCGAGCCCTTCGACGACGTCACCAAGATTCTCGCTCGCTTCGAGGATGCCGGCAAGTTTACCCCCGCTGAGGTTGTTGCCCTGCTTGCCT
C
GTATGTCCCCACATACCCTCGTTCTTAGACCTTACACTGACCCACGTCTCACAGGCACACGATCGCCGCTGCCGACCACGTCGACCCCACCATCCCGGGAACGCCCTTCGACTCCACCC
CCGAGCTGTTCGACACCCAGTTCTTCATCGAGACGCAGCTCAAAGGCACGCTCTTCCCCGGCAACGGCAGCAACCAGGGTGAGGTCGAGTCTCCCCTCGGCGGTGAGCTCCGTCTCCAGT
CCGATGGCCTCCTTGCGCGCGACCAGCGCACCGCCTGCGAGTGGCAGTCGTTCGTCAACAACCAGGCGAAGCTCCAGAGCGCGTTCAAGGCCGCGTTCGCGAAGATGACCGTGCTCGGCC
AGAACACCCGCGCGCTCATCGACTGCTCGGACGTCGTCCCCACCCCGCCCGCCGCCGCCAGCAAGGCGCACTTCCCCGCCGGCCTCTCCCACCGCGACATCGAGCAGGCGTGCCGCGCAA
CGCCCTTCCCCACGCTCCCCACGGACCCCGGACCCGTCACCACCGTCGCCCCTGT
GTAAGTCCAGCTCTCCCCTCAGATGACAGGAGCTTGTGCTGATGACTGGTTCTGCAGCCCCCCGT
CCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTCAAGCTCCTTGGTTCCTTCGTCTCCCTCCTCGCGGCCCTCCAGGTCGCTAACGGTGCCCTCACCCGCCGTGTGACGTGCGCCACCGGCCAGGTCACCTCGAACGCGGCCTGC
TGCGCGCTCTTCCCCGTCATCGACGACATCCAGACGAACCTGTTCGACGGCGGCGAGTGCGGTGAGGAGGTCCACGAGTCCCTCCGCCTCACCTTCCACGACGCCATCGGCATCTCGCCC
GCCATCGCCAAGACCGGTGTCTTCGGTGGTGGAGGCGCGGACGGCTCCATTGCCATCTTCGCCGACATCGAGACGAACTTCCACGCCAACAACGGCGTTGACGAGATCATCGGCGAGCAG
GCGCCCTTCATCGCCCGCCACAACCTGACCACCGCCGACTT
CATCCAGTTGGCCGGTGCCATCGGTGTCTCCAACTGCCCTGGCGCGCCCCGCCTGAACGTCTTCATCGGCCGCAAGGAC
GCGACCCAGCCCGCTCCCGACCTGACGGTCCCCGAGCCCTTCGACGACGTCACCAAGATTCTCGCTCGCTTCGAGGATGCCGGCAAGTTTACCCCCGCTGAGGTTGTTGCCCTGCTTGCC
TC
GCACACGATCGCCGCTGCCGACCACGTCGACCCCACCATCCCGGGAACGCCCTTCGACTCCACCCCCGAGCTGTTCGACACCCAGTTCTTCATCGAGACGCAGCTCAAAGGCACGCTC
TTCCCCGGCAACGGCAGCAACCAGGGTGAGGTCGAGTCTCCCCTCGGCGGTGAGCTCCGTCTCCAGTCCGATGGCCTCCTTGCGCGCGACCAGCGCACCGCCTGCGAGTGGCAGTCGTTC
GTCAACAACCAGGCGAAGCTCCAGAGCGCGTTCAAGGCCGCGTTCGCGAAGATGACCGTGCTCGGCCAGAACACCCGCGCGCTCATCGACTGCTCGGACGTCGTCCCCACCCCGCCCGCC
GCCGCCAGCAAGGCGCACTTCCCCGCCGGCCTCTCCCACCGCGACATCGAGCAGGCGTGCCGCGCAACGCCCTTCCCCACGCTCCCCACGGACCCCGGACCCGTCACCACCGTCGCCCCT
GT
CCCCCCGTCCTAA

Retrieve as FASTA