Entry information : HpulCIIAB01
Entry ID 8539
Creation 2011-09-26 (Christophe Dunand)
Last sequence changes 2011-09-26 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2013-10-15 (Catherine Mathe (Scipio))
Peroxidase information: HpulCIIAB01
Name HpulCIIAB01
Class Asco Class II type B    [Orthogroup: CIIAB001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Hysteriaceae Hysterium
Organism Hysterium pulicare    [TaxId: 100027 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HpulCIIAB01
start..stop
S start..stop
RrufCIIAB02 463 4e-166 1..317 1..317
GsteCIIAB01 407 5e-144 1..315 1..313
CgeoCIIAB01 403 3e-142 1..312 1..311
LpaluCIIAB01 357 3e-124 1..305 1..306
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 61004..61421 418 N° 2 60540..60945 406 N° 3 60362..60488 127  
complement(join(60362..60488,60540..60945,61004..61421))


exon

Literature and cross-references HpulCIIAB01
DNA ref. JGI genome:   NODE_46_length_156609_cov_26.751509 (61421..60362)
Protein sequence: HpulCIIAB01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317 (298)
PWM (Da):   %s   32775.42 (30838.4)  
PI (pH):   %s   6.88 (6.88) Peptide Signal:   %s   cut: 20 range:20-317
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MYILSSLFSLLAVAASAQAFKLPEVALLTRELNIPSLYAIRRSISDALRPRASCPSVWSDISKQLTSDFLSGGQCNDNARAAIRAAFHDCFNGGCDGSLILANECSRTENNGLQSICSSLGDMAKSNDVGVADLIQFAAAHAVKTCPLGPTVPAYVGRKDSSSASPEGGLPSAFASGDDLYAQFQAKGFSATDLAALIGAHSTAKQFFVDTPKAGAALDSTPGIWDVAYYGQTLSGTAPFTLQSDANLAKHDVVGKPFKGFVLNQPGWNTAFVSAMSKVSLMGVDGGSGSLTDCTTALPGGTLKRDLKAAPINGRI

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTATATTCTATCTTCATTGTTCTCCCTTCTGGCTGTTGCAGCCTCTGCTCAGGCTTTTAAGCTCCCAGAAGTTGCCCTGCTTACACGTGAACTCAACATCCCATCACTATATGCGATC
AGACGTTCAATCTCAGATGCTTTGAGACCTCGCGCTTCTTGCCCTTCTGTATGGTCCGACATATCCAAACAACTCACATCAGATTTTCTCTCCGGAGGTCAGTGTAACGATAATGCTCGA
GCTGCCATTCGGGCTGCTTTCCATGATTGCTTCAACGGAGGGTGTGATGGCTCTTTGATTCTTGCCAATGAGTGCAGCAGGACGGAGAACAATGGGCTTCAGAGCATATGCTCCAGTCTA
GGTGACATGGCGAAGTCGAATGATGTTGGTGTTGCAGACCTCATTCAATTCGCTGCAG
GTACTACCCTCTTCTCCCCATTATCTTCACTATGCCTGTGAACTCACGCTTCTATCAGCACA
CGCAGTCAAGACCTGCCCGTTAGGTCCCACAGTTCCCGCATATGTTGGCCGCAAAGATTCCAGCTCTGCCTCTCCTGAAGGTGGACTCCCATCCGCTTTCGCTTCCGGTGATGATCTCTA
TGCGCAATTCCAAGCTAAAGGCTTCAGCGCCACAGATCTTGCCGCCCTTATTGGCGCACACTCAACCGCAAAGCAGTTCTTCGTCGACACTCCCAAAGCAGGTGCAGCTCTGGATTCTAC
TCCTGGAATATGGGATGTGGCATATTACGGCCAGACTCTCAGCGGTACTGCACCGTTTACTCTCCAGAGTGATGCTAATCTTGCAAAACATGATGTTGTTGGCAAGCCTTTCAAAGGCTT
TGTTCTGAACCAGCCGGGCTGGAATACGGCTTTTGTATCTGC
GTATGTACCTAATCACTTTGGACTGACGGTTGGCTAACGTATTCCTATTAGTATGTCTAAGGTGTCGCTCATGGGCGT
CGATGGCGGATCTGGGTCTCTTACGGATTGCACGACTGCGCTTCCTGGCGGCACCTTGAAGCGGGACCTCAAGGCTGCTCCAATCAACGGCCGCATTCTA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTATATTCTATCTTCATTGTTCTCCCTTCTGGCTGTTGCAGCCTCTGCTCAGGCTTTTAAGCTCCCAGAAGTTGCCCTGCTTACACGTGAACTCAACATCCCATCACTATATGCGATC
AGACGTTCAATCTCAGATGCTTTGAGACCTCGCGCTTCTTGCCCTTCTGTATGGTCCGACATATCCAAACAACTCACATCAGATTTTCTCTCCGGAGGTCAGTGTAACGATAATGCTCGA
GCTGCCATTCGGGCTGCTTTCCATGATTGCTTCAACGGAGGGTGTGATGGCTCTTTGATTCTTGCCAATGAGTGCAGCAGGACGGAGAACAATGGGCTTCAGAGCATATGCTCCAGTCTA
GGTGACATGGCGAAGTCGAATGATGTTGGTGTTGCAGACCTCATTCAATTCGCTGCAG
CACACGCAGTCAAGACCTGCCCGTTAGGTCCCACAGTTCCCGCATATGTTGGCCGCAAAGAT
TCCAGCTCTGCCTCTCCTGAAGGTGGACTCCCATCCGCTTTCGCTTCCGGTGATGATCTCTATGCGCAATTCCAAGCTAAAGGCTTCAGCGCCACAGATCTTGCCGCCCTTATTGGCGCA
CACTCAACCGCAAAGCAGTTCTTCGTCGACACTCCCAAAGCAGGTGCAGCTCTGGATTCTACTCCTGGAATATGGGATGTGGCATATTACGGCCAGACTCTCAGCGGTACTGCACCGTTT
ACTCTCCAGAGTGATGCTAATCTTGCAAAACATGATGTTGTTGGCAAGCCTTTCAAAGGCTTTGTTCTGAACCAGCCGGGCTGGAATACGGCTTTTGTATCTGC
TATGTCTAAGGTGTCG
CTCATGGGCGTCGATGGCGGATCTGGGTCTCTTACGGATTGCACGACTGCGCTTCCTGGCGGCACCTTGAAGCGGGACCTCAAGGCTGCTCCAATCAACGGCCGCATTCTA

Retrieve as FASTA