Entry information : SbPrx116 (Sobic.009G055300.1 [2.4] / Sb09g004660 [1.4])
Entry ID 854
Creation 2006-01-02 (Christophe Dunand)
Last sequence changes 2006-01-02 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-07-31 (Christophe Dunand)
Peroxidase information: SbPrx116 (Sobic.009G055300.1 [2.4] / Sb09g004660 [1.4])
Name (synonym) SbPrx116 (Sobic.009G055300.1 [2.4] / Sb09g004660 [1.4])
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Leaves
Roots
Seedlings
Inducers Heat shock stress
Nitrogen starvation
Oxidative stress
Phosphate starvation
Salt stress
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx116
start..stop
S start..stop
ZmPrx39 612 0 11..363 4..357
ZmPrx03_B73 609 0 7..363 2..360
ZmPrx03_Du101 607 0 10..363 2..357
SbPrx115 606 0 25..363 20..357
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5630736..5630960 225 N° 2 5629926..5630378 453 N° 3 5629140..5629553 414  
complement(join(5629140..5629553,5629926..5630378,5630736..5630960))


exon

Literature and cross-references SbPrx116 (Sobic.009G055300.1 [2.4] / Sb09g004660 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chromosome_9 (5630960..5629140)
Cluster/Prediction ref. PlantGDB:   SbGSStuc11-12-04.8944.1
Protein sequence: SbPrx116 (Sobic.009G055300.1 [2.4] / Sb09g004660 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   363 (334)
PWM (Da):   %s   38167.05 (35022.4) Transmb domain:   %s   i13-35o
PI (pH):   %s   6.12 (4.91) Peptide Signal:   %s   cut: 30 range:30-363
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTTATTTTMKRRFLRFATVLASLLSATACLDVGFYDQTCPTAETVVQQTVAAAFTNNSGVAPALIRMHFHDCFVRGCDGSVLIDSTANNTAEKDAPPNNPSLRFFDVVDSAKAALEAQCPGVVSCADVLAFAARDSVVLSGGLGYQVPAGRRDGLISTATEALNNLPPPFFNATQLAASFASKNLTVEDLVVLSGAHTLGVSHCSSFAGVGNLGDRLYNFSGSSDGTDPALSKAYAFLLKSICPSNSSQFFPNTTTFMDLITPEKFDNKYYVGLTNNLGLFKSDVALLTNATMKALVDSFVRSEATFRTKFARSMLKMGQIEVLTGTQGEIRLNCRVINPANAAADVLADQSGSSGFTGVAAS*

Retrieve as FASTA  
Remarks Complete sequence from 12 ESTs (TC102108) + from 14 ESTs (TC102109) and genomic (chromo 9, introns 1 and 3'). Containing IntR (3').
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGACGGCGACGACGACGACGATGAAGCGCCGCTTCTTACGGTTCGCCACCGTCCTGGCGTCGCTCCTCTCGGCCACCGCCTGCCTCGACGTCGGCTTCTACGACCAGACGTGCCCC
ACCGCCGAGACCGTCGTGCAGCAGACCGTGGCCGCCGCGTTCACCAACAACTCCGGCGTCGCTCCGGCACTCATCCGCATGCACTTTCATGACTGCTTTGTCAGG
GTAAGTAGTACACGC
ATGCAGTATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAGCTAGACATATATACTTTTCACTACTACATTACCTTTAAACTCCTTGCATGCAT
GTTAATATTACCAACAGAATTTCGAGTTATAAATGTTGCTTTTGGAACTTTTACCTTCTTCAGCTTTGCCACGAAACTTTGTTTTCGATATTGCGTGGATCTTTGTTTTGGTGCTTGTAA
TAAGGAACAGCTATATACATTAGTCGATGCACAAGCTGAGACATTAATATATTTATTTTTCTAAATAAAAATATTACCTTTAAACTCCTTGCATGCATGCAGGGCTGCGACGGCTCGGTG
CTGATCGACTCCACGGCGAACAACACGGCGGAGAAGGACGCGCCACCCAACAACCCGAGCCTCCGGTTCTTCGACGTGGTCGACAGCGCCAAGGCGGCGCTGGAGGCGCAGTGCCCCGGC
GTGGTCTCCTGCGCCGACGTCCTCGCCTTCGCGGCGAGGGACAGCGTCGTGCTCTCCGGCGGCCTCGGCTACCAGGTGCCCGCCGGACGCCGTGACGGCCTGATATCCACTGCCACTGAG
GCCCTCAACAACCTGCCTCCGCCGTTCTTCAACGCCACCCAACTGGCAGCCAGCTTCGCCTCCAAGAACCTCACCGTTGAGGACCTCGTCGTGCTCTCCGGCGCCCACACCCTCGGTGTC
TCCCATTGCAGCAGCTTCGCCGGAGTTGGCAACCTGGGCGACCGTCTCTACAACTTCAGCGGCTCATCTGACGGG
GTAAGAAGCTAGCATATATAACAGCAGTTCCCTCTCTACAAACTA
AGCATAATTAACACTTCGGTTAGAGCGTGTGTTTGGTTGGAGGTGTAAAAGTTTAATGGATACAGTAGTATTTTCATTTTATTTAGCAATTAGTGTCCAATCATGGACTAATTATGCTCA
AAAGATTCGTCTTGCAAATTACTTAATTTCTAGCTATGTTTTCAGTTTCATAAATAGTTTATATTTAGTACTTCATGCATGTATCCATATATATGATAAGAGTTAAAGTTTAACAAAGGT
AATCAAACGGGCCTAGTTTCTTACCCTTTTTTTTTAGCAAAGTTTCTTACCCAGTATGTTATCCATATCCACTGCTGTTGTGTACAGACTGACCCGGCACTGAGCAAAGCCTACGCATTT
CTGCTCAAGAGCATCTGCCCGTCCAACAGCAGCCAGTTCTTCCCCAACACGACGACGTTCATGGACCTCATCACGCCGGAAAAGTTCGACAACAAGTACTACGTCGGCCTGACAAACAAC
CTGGGGCTCTTCAAATCAGATGTGGCGCTGCTGACCAACGCAACGATGAAGGCGCTGGTCGACTCCTTCGTGCGCAGCGAGGCGACTTTCAGGACCAAGTTCGCCAGGTCCATGCTCAAG
ATGGGGCAGATCGAGGTGCTGACCGGGACGCAGGGAGAGATCAGGCTCAATTGCAGGGTCATCAACCCTGCTAATGCTGCTGCTGATGTTCTTGCCGATCAATCGGGTTCTTCAGGATTC
ACTGGAGTGGCTGCAAGCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGACGGCGACGACGACGACGATGAAGCGCCGCTTCTTACGGTTCGCCACCGTCCTGGCGTCGCTCCTCTCGGCCACCGCCTGCCTCGACGTCGGCTTCTACGACCAGACGTGCCCC
ACCGCCGAGACCGTCGTGCAGCAGACCGTGGCCGCCGCGTTCACCAACAACTCCGGCGTCGCTCCGGCACTCATCCGCATGCACTTTCATGACTGCTTTGTCAGG
GGCTGCGACGGCTCG
GTGCTGATCGACTCCACGGCGAACAACACGGCGGAGAAGGACGCGCCACCCAACAACCCGAGCCTCCGGTTCTTCGACGTGGTCGACAGCGCCAAGGCGGCGCTGGAGGCGCAGTGCCCC
GGCGTGGTCTCCTGCGCCGACGTCCTCGCCTTCGCGGCGAGGGACAGCGTCGTGCTCTCCGGCGGCCTCGGCTACCAGGTGCCCGCCGGACGCCGTGACGGCCTGATATCCACTGCCACT
GAGGCCCTCAACAACCTGCCTCCGCCGTTCTTCAACGCCACCCAACTGGCAGCCAGCTTCGCCTCCAAGAACCTCACCGTTGAGGACCTCGTCGTGCTCTCCGGCGCCCACACCCTCGGT
GTCTCCCATTGCAGCAGCTTCGCCGGAGTTGGCAACCTGGGCGACCGTCTCTACAACTTCAGCGGCTCATCTGACGGG
ACTGACCCGGCACTGAGCAAAGCCTACGCATTTCTGCTCAAG
AGCATCTGCCCGTCCAACAGCAGCCAGTTCTTCCCCAACACGACGACGTTCATGGACCTCATCACGCCGGAAAAGTTCGACAACAAGTACTACGTCGGCCTGACAAACAACCTGGGGCTC
TTCAAATCAGATGTGGCGCTGCTGACCAACGCAACGATGAAGGCGCTGGTCGACTCCTTCGTGCGCAGCGAGGCGACTTTCAGGACCAAGTTCGCCAGGTCCATGCTCAAGATGGGGCAG
ATCGAGGTGCTGACCGGGACGCAGGGAGAGATCAGGCTCAATTGCAGGGTCATCAACCCTGCTAATGCTGCTGCTGATGTTCTTGCCGATCAATCGGGTTCTTCAGGATTCACTGGAGTG
GCTGCAAGCTAA

Retrieve as FASTA