Entry information : PoDyPrx01_other (dyp)
Entry ID 8569
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-11-30 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-05 (Christophe Dunand)
Peroxidase information: PoDyPrx01_other (dyp)
Name (synonym) PoDyPrx01_other (dyp)
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Pleurotaceae Pleurotus
Organism Pleurotus ostreatus (Oyster mushroom)    [TaxId: 5322 ]
Cellular localisation N/D
Tissue type Berries
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PoDyPrx01_other
start..stop
S start..stop
PoDyPrx01_PC15 1063 0 1..525 1..516
PoDyPrx02_PC15 701 0 1..525 1..511
PoDyPrx03_PC15 634 0 51..525 6..479
PstrDyPrx01 451 4e-155 51..525 44..505
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 527..658 132 N° 2 684..814 131 N° 3 873..976 104 N° 4 1030..1403 374
N° 5 1465..1661 197 N° 6 1718..1802 85 N° 7 1856..2084 229 N° 8 2136..2192 57
N° 9 2251..2317 67 N° 10 2368..2569 202  
join(527..658,684..814,873..976,1030..1403,1465..1661,1718..1802,1856..2084,2136 ..2192,2251..2317,2368..2569)


exon

Literature and cross-references PoDyPrx01_other (dyp)
Protein ref. UniProtKB:   Q0VTU1
DNA ref. GenBank:   AM283034.1
Protein sequence: PoDyPrx01_other (dyp)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   525 (506)
PWM (Da):   %s   58146.06 (55896.9)  
PI (pH):   %s   5.63 (5.45) Peptide Signal:   %s   cut: 20 range:20-525
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRWWTTCVALTSLIPYTLLPSYGFSLPQQLEARQNDYPSGSLLHDCVLTRLPVDYPGQHTLPTLELIQKLNATNGTFLPLEEIQGDIMIGMRKPKEIFFFYSIQNPRKFKSVLAKLIYPHITTAQMVCTTCTQPSAMLNVAWTSQGLRKLGVLDDLGDPYFAMGQLNDAAALGDTDPSTTWAPGLYANKTDGAFLIAARDWEPIDTLLNQMKNWLGDAIVETHSNRGAVRPGDAAGKEHFGWLDGIQPAVAGFATSTYPGQQLLLPGTLLTKEIGDPRRAARPAWTKWGSFMAYRQLQELVPEFDDYLMQEAALIQDSSRSVRERADLLGARMFGRWKGTPLDLAPERDDPSIGPNLMLNNNFDFNHPAPFDINSNQSYCPFSAHIRKIRPRADQGNTNLKNQMIRASIPYGEELSDDEINSKKTATERGVAFVTYQSDLGSGFHFQQAEWANNVNIPTGKSDPTPGFDPIVGQNNGKPLVVSGIDYTDLNHDLTFMSFVVSKGGDYFFSPSMSAILHKIAA

Retrieve as FASTA  
Remarks Complete sequence from genomic
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGCTGGTGGACTACCTGCGTCGCTCTCACTTCGTTAATACCTTACACCCTCCTGCCCAGTTATGGGTTCAGTCTGCCCCAGCAGCTCGAGGCGAGGCAGAACGACTATCCGAGTGGA
TCACTGTTACAC
GGCGAGTTGCACTATTTCCTGCCAAGATTGCGTGCTCACTCGCCTACCCGTAGATTATCCTGGGCAGCATACATTGCCAACGCTTGAGTTGATCCAGAAATTGAATGC
CACTAATGGCACATTCCTTCCGCTGGAGGAGATTCAAGGAGACATCAT
GTACGCATTCCGTTCGCTTGAAGTCGTGCCCTGTGTCTCTAACGCACTGTCTCCCTAGGATTGGGATGAGGA
AGCCCAAGGAAATATTCTTTTTCTACTCGATTCAGAACCCAAGAAAGTTCAAGAGTGTCCTCGCGAAACTGATCTACCCTCATATTACCA
GTAATATATCCTATTATCTCAGGAGAGTAC
TAATTCTTATATTCTTGAGTTAGCGACTGCTCAAATGGTCTGCACTACCTGCACGCAACCATCAGCTATGCTGAACGTTGCTTGGACCTCACAAGGCCTTCGTAAACTTGGTGTATTGGA
CGACCTCGGGGATCCCTACTTCGCCATGGGGCAATTAAACGACGCTGCAGCCCTTGGCGATACCGATCCAAGCACAACGTGGGCCCCAGGTCTTTATGCGAACAAGACGGACGGTGCTTT
CCTGATTGCGGCTAGAGATTGGGAGCCTATCGACACCTTACTGAATCAAATGAAGAATTGGTTGGGCGATGCGATCGTAGAAACGCACAGCAACAGGGGCGCGGTACGACCCGGCGATGC
GGCTGGTAAAGAACACTTTGGTTGGCTTGATGGCTTC
GTAAGTGACTCCTTTTCAAGTTGAAGGAAATTTTGCGGCTCACCCATCGTCTTCGTGACAGATTCAACCCGCAGTCGCTGGTT
TTGCTACGAGCACCTACCCCGGACAACAGCTTCTTCTACCTGGCACGCTTCTGACCAAAGAAATTGGCGATCCCCGCAGAGCTGCCCGACCAGCATGGACGAAATGGGGCTCCTTCATGG
CATACCGACAACTCCAAGAGCTCGTTCCTGAGTTCGATGACTACCTCATGCAAGA
GTTCGTCGCTCAATCACTCCTTCGTTGCAATGTTATATTGATCACACCCACCCCAGAGCTGCTTT
AATCCAAGACTCGTCGAGGAGCGTTCGCGAGCGTGCTGATCTTCTTGGCGCCCGTATGTTCGGTCGCTGGAAGAGC
GTCAGTTGTTATTTCGCATTCTATGCGCCATATTTGCTCATCCA
CGAAACTAGGGTACTCCTCTTGACCTTGCCCCAGAGAGGGATGATCCCTCCATTGGCCCAAATCTTATGCTTAACAACAACTTCGACTTCAATCACCCTGCGCCCTTCGATATCAACAGT
AACCAGTCCTATTGTCCCTTCTCCGCACACATCCGCAAGATTCGTCCCCGCGCTGACCAGGGAAACACAAACCTCAAGAACCAAATGATTAGGGCAAGTATACCCTATGGCGAAGAGC
GT
AAGTAGTTTCATCCACGTCGTTTCTTGGCTGTAGCTCATGTTCCTTCAGTCAGCGACGATGAGATCAACAGCAAGAAAACAGCGACTGAACGTGGTGTGGCGTTCGGTAGGCCCCCTACC
TATATTTGCTAGATTCCGTTCTCACGCATCTATACCAATTCTAGTGACATATCAGAGTGATCTCGGCTCCGGGTTCCACTTCCAGCAAGCCGAGTGGGCTAACAACGTCAAGTCAGTCAC
AATCTACACCCATTGCTGAACCCATCTAATCCCTCACCTAGCATTCCCACCGGTAAAAGCGACCCAACGCCTGGATTTGACCCAATTGTCGGCCAGAACAACGGCAAACCGCTTGTTGTG
TCTGGGATCGACTACACAGACCTCAATCACGACTTGACTTTCATGAGCTTCGTTGTGTCTAAGGGAGGTGACTACTTCTTCAGCCCCTCCATGTCCGCCATCTTGCACAAAATCGCTGCT
TAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGCTGGTGGACTACCTGCGTCGCTCTCACTTCGTTAATACCTTACACCCTCCTGCCCAGTTATGGGTTCAGTCTGCCCCAGCAGCTCGAGGCGAGGCAGAACGACTATCCGAGTGGA
TCACTGTTACAC
GATTGCGTGCTCACTCGCCTACCCGTAGATTATCCTGGGCAGCATACATTGCCAACGCTTGAGTTGATCCAGAAATTGAATGCCACTAATGGCACATTCCTTCCGCTG
GAGGAGATTCAAGGAGACATCAT
GATTGGGATGAGGAAGCCCAAGGAAATATTCTTTTTCTACTCGATTCAGAACCCAAGAAAGTTCAAGAGTGTCCTCGCGAAACTGATCTACCCTCAT
ATTACCA
CGACTGCTCAAATGGTCTGCACTACCTGCACGCAACCATCAGCTATGCTGAACGTTGCTTGGACCTCACAAGGCCTTCGTAAACTTGGTGTATTGGACGACCTCGGGGATCCC
TACTTCGCCATGGGGCAATTAAACGACGCTGCAGCCCTTGGCGATACCGATCCAAGCACAACGTGGGCCCCAGGTCTTTATGCGAACAAGACGGACGGTGCTTTCCTGATTGCGGCTAGA
GATTGGGAGCCTATCGACACCTTACTGAATCAAATGAAGAATTGGTTGGGCGATGCGATCGTAGAAACGCACAGCAACAGGGGCGCGGTACGACCCGGCGATGCGGCTGGTAAAGAACAC
TTTGGTTGGCTTGATGGCTTC
ATTCAACCCGCAGTCGCTGGTTTTGCTACGAGCACCTACCCCGGACAACAGCTTCTTCTACCTGGCACGCTTCTGACCAAAGAAATTGGCGATCCCCGC
AGAGCTGCCCGACCAGCATGGACGAAATGGGGCTCCTTCATGGCATACCGACAACTCCAAGAGCTCGTTCCTGAGTTCGATGACTACCTCATGCAAGA
AGCTGCTTTAATCCAAGACTCG
TCGAGGAGCGTTCGCGAGCGTGCTGATCTTCTTGGCGCCCGTATGTTCGGTCGCTGGAAGAGC
GGTACTCCTCTTGACCTTGCCCCAGAGAGGGATGATCCCTCCATTGGCCCAAATCTT
ATGCTTAACAACAACTTCGACTTCAATCACCCTGCGCCCTTCGATATCAACAGTAACCAGTCCTATTGTCCCTTCTCCGCACACATCCGCAAGATTCGTCCCCGCGCTGACCAGGGAAAC
ACAAACCTCAAGAACCAAATGATTAGGGCAAGTATACCCTATGGCGAAGAGC
TCAGCGACGATGAGATCAACAGCAAGAAAACAGCGACTGAACGTGGTGTGGCGTTCGTGACATATCAG
AGTGATCTCGGCTCCGGGTTCCACTTCCAGCAAGCCGAGTGGGCTAACAACGTCAA
CATTCCCACCGGTAAAAGCGACCCAACGCCTGGATTTGACCCAATTGTCGGCCAGAACAACGGC
AAACCGCTTGTTGTGTCTGGGATCGACTACACAGACCTCAATCACGACTTGACTTTCATGAGCTTCGTTGTGTCTAAGGGAGGTGACTACTTCTTCAGCCCCTCCATGTCCGCCATCTTG
CACAAAATCGCTGCTTAA

Retrieve as FASTA