Entry information : AcoPrx05 (AcoGoldSmith_v1.006987m)
Entry ID 8570
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-09-28 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-14 (Qiang Li)
Peroxidase information: AcoPrx05 (AcoGoldSmith_v1.006987m)
Name (synonym) AcoPrx05 (AcoGoldSmith_v1.006987m)
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx05
start..stop
S start..stop
AfpPrx02 662 0 55..370 1..316
AcoPrx09 543 0 1..365 1..363
AfpPrx04 538 0 1..365 1..363
AfpPrx11 503 3e-180 1..370 1..369
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1672254..1672583 330 N° 2 1672821..1673009 189 N° 3 1673098..1673263 166 N° 4 1673638..1674065 428
join(1672254..1672583,1672821..1673009,1673098..1673263,1673638..1674065)


exon

Literature and cross-references AcoPrx05 (AcoGoldSmith_v1.006987m)
DNA ref. Phytozome 12:   scaffold_20 (1672254..1674065)
Protein sequence: AcoPrx05 (AcoGoldSmith_v1.006987m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   371 (350)
PWM (Da):   %s   41071.5 (38806.2)  
PI (pH):   %s   7.26 (7.26) Peptide Signal:   %s   cut: 21 range:21-370
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MWEIAKKLGVLVLTVSLVVSLANQSGEQQKNGSGGSLDSSSFSWIRPLLFSNNDMKMINFNENTLEYDFYRDSCPQAEQIVRSTIHRLYKKHSSVAPALLRLLFHDCFIQGCDASVLLDSTSEFQSEKDTPPNQTLKGFHIIETIKSKLEEVCPATVSCADILVLAAREGVSLAGGPYYPLLTGRRDSFVSFPEVASYELPSPHDDLSKTLTSFASRGFDERETVSLLGAHNIGKIHCRFFRNRLYNFAGTGLPDPSLDAGTLNLMRSRCNNSKSHSEEPGMNMGYEGKTGPEFGTHYYKTLMQGKGILHADQQLMAGEGTASWVEAYASERSLFRRDFAQVMMKLSSLRVLTKSLGQIRLNCSRGSFEV*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGGGAAATTGCAAAGAAATTAGGTGTTTTAGTGTTAACAGTTTCATTAGTTGTGTCACTTGCTAATCAAAGTGGAGAACAACAAAAGAATGGTAGTGGTGGTAGTTTAGATTCTTCG
AGTTTTTCATGGATTCGTCCTTTGCTTTTCTCTAATAATGATATGAAGATGATCAATTTCAATGAAAATACACTTGAATATGATTTCTATCGAGATTCTTGTCCACAAGCTGAACAGATT
GTTCGATCAACCATTCATCGTCTTTACAAGAAACATTCTAGTGTTGCTCCAGCTTTGCTCCGATTACTCTTCCATGATTGCTTCATTCAG
GTAGCTTTTACTCAGTTTTTAGATATTTTA
CTTAATTGGCTTCTTTGTTGTCTTTGTTCTTGTTATCTTTGAATGGAGTTTTGATTTGGGTTCTATTTGTTTGATTTTGGGTCTCAATGAGGGTAGAGGGTTCTATTAATTCAGATTTGT
TAATTTCATCTTTGTCTGAAGTTATGATGTTGGTTCTTGTTGTTTCGATTGCATTTGCTTGTTATTGATTTAATGGGATTGATTCAGGGATGTGATGCTTCAGTTCTTTTGGATTCAACT
TCTGAATTTCAGTCAGAGAAAGACACTCCACCCAATCAGACTTTGAAAGGTTTCCATATAATCGAAACAATCAAATCGAAATTGGAAGAAGTATGTCCTGCAACTGTTTCTTGTGCTGAT
ATTCTAGTTCTTGCAGCTAGAGAAGGAGTTTCTTTG
GTAATGTATTGAGTTTATTTGTTGATTGTCTTTTTTTTTTTTGCTATTTGTTTCGTCGATTTTGCTCTTCTGATTGTTGTCATC
ACAGGCTGGTGGTCCTTACTATCCTCTGCTTACTGGAAGGCGTGACAGTTTTGTATCATTTCCTGAAGTCGCGTCTTATGAGCTACCTTCTCCTCATGATGATCTTTCCAAGACCCTTAC
ATCCTTTGCTAGTAGGGGATTTGATGAAAGGGAGACTGTCAGTCTCTTAG
GTAAGCATATTGTTCTTCTATCTTAACTATCTACTTCTGAGTACAGTATTTGATTGTGATTGGTTTTGTT
TCCTGTTCTGAATTTCTGTTTGAAACCGAACTATAGGATAGATATTTCAACCAACTTCCTTTTCTTCGTCAGTTCATGACCTTACAAATACTTATTATATTTTCACTATGAGTCTAAGAG
CAATAAATCACGAATTCAAATAGAAGTAGCTTGTGAGTCATTGTTTCTGCTTTTAACAAATAATTTTATGTTATATTCTTGGCTGGGTAAGTAGCTTGTCAGTCATTGTTCTTGTTATTG
TAATCATATTTAACAGGACTACAATTGAAAGTCTTGGTAATGGAATTATTACGGTGTTCATCAGGTGCTCACAATATTGGAAAAATTCACTGCCGGTTCTTCCGCAATCGCCTATACAAC
TTTGCAGGGACTGGCTTACCTGACCCGTCTCTTGATGCTGGAACTCTCAATCTGATGAGGTCCAGATGTAATAACAGCAAGAGTCACTCAGAGGAGCCAGGCATGAATATGGGCTATGAG
GGAAAAACAGGACCCGAGTTTGGTACACACTACTACAAAACTTTGATGCAAGGGAAGGGTATTCTACATGCTGATCAGCAGTTGATGGCTGGTGAAGGAACTGCAAGCTGGGTCGAAGCC
TATGCATCAGAAAGGTCACTGTTTCGCCGGGATTTTGCACAAGTTATGATGAAGCTTTCAAGCCTTCGAGTCCTGACAAAATCGCTAGGCCAGATAAGGCTCAATTGCTCTAGGGGTTCC
TTCGAAGTATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGGGAAATTGCAAAGAAATTAGGTGTTTTAGTGTTAACAGTTTCATTAGTTGTGTCACTTGCTAATCAAAGTGGAGAACAACAAAAGAATGGTAGTGGTGGTAGTTTAGATTCTTCG
AGTTTTTCATGGATTCGTCCTTTGCTTTTCTCTAATAATGATATGAAGATGATCAATTTCAATGAAAATACACTTGAATATGATTTCTATCGAGATTCTTGTCCACAAGCTGAACAGATT
GTTCGATCAACCATTCATCGTCTTTACAAGAAACATTCTAGTGTTGCTCCAGCTTTGCTCCGATTACTCTTCCATGATTGCTTCATTCAG
GGATGTGATGCTTCAGTTCTTTTGGATTCA
ACTTCTGAATTTCAGTCAGAGAAAGACACTCCACCCAATCAGACTTTGAAAGGTTTCCATATAATCGAAACAATCAAATCGAAATTGGAAGAAGTATGTCCTGCAACTGTTTCTTGTGCT
GATATTCTAGTTCTTGCAGCTAGAGAAGGAGTTTCTTTG
GCTGGTGGTCCTTACTATCCTCTGCTTACTGGAAGGCGTGACAGTTTTGTATCATTTCCTGAAGTCGCGTCTTATGAGCTA
CCTTCTCCTCATGATGATCTTTCCAAGACCCTTACATCCTTTGCTAGTAGGGGATTTGATGAAAGGGAGACTGTCAGTCTCTTAG
GTGCTCACAATATTGGAAAAATTCACTGCCGGTTC
TTCCGCAATCGCCTATACAACTTTGCAGGGACTGGCTTACCTGACCCGTCTCTTGATGCTGGAACTCTCAATCTGATGAGGTCCAGATGTAATAACAGCAAGAGTCACTCAGAGGAGCCA
GGCATGAATATGGGCTATGAGGGAAAAACAGGACCCGAGTTTGGTACACACTACTACAAAACTTTGATGCAAGGGAAGGGTATTCTACATGCTGATCAGCAGTTGATGGCTGGTGAAGGA
ACTGCAAGCTGGGTCGAAGCCTATGCATCAGAAAGGTCACTGTTTCGCCGGGATTTTGCACAAGTTATGATGAAGCTTTCAAGCCTTCGAGTCCTGACAAAATCGCTAGGCCAGATAAGG
CTCAATTGCTCTAGGGGTTCCTTCGAAGTATGA

Retrieve as FASTA