Entry information : AcoPrx12 (AcoGoldSmith_v1.007614m)
Entry ID 8576
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-14 (Qiang Li)
Peroxidase information: AcoPrx12 (AcoGoldSmith_v1.007614m)
Name (synonym) AcoPrx12 (AcoGoldSmith_v1.007614m)
Class Class III peroxidase    [Orthogroup: Prx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx12
start..stop
S start..stop
AfpPrx26 715 0 1..352 1..352
AfpPrx19 618 0 27..352 27..353
AcoPrx11 618 0 25..352 25..353
AcoPrx10 509 0 2..352 3..354
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3489156..3489401 246 N° 2 3489626..3489820 195 N° 3 3489948..3490565 618  
join(3489156..3489401,3489626..3489820,3489948..3490565)


exon

Literature and cross-references AcoPrx12 (AcoGoldSmith_v1.007614m)
DNA ref. Phytozome 12:   scaffold_23 (3489156..3490565)
Protein sequence: AcoPrx12 (AcoGoldSmith_v1.007614m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   353 (325)
PWM (Da):   %s   38646.49 (35665.9)  
PI (pH):   %s   7.06 (6.66) Peptide Signal:   %s   cut: 28 range:28-352
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTSSASFISLLFLSSLILGSHLSLTRAQPTPPLVGGLSWTFHRTNCPNLETIVRDYLRQVFRDDIGQAAGLLRIHFHDCFVQGCDGSVLLAGSASGPGEQEAPPNLTLRPQAFTIINELRNRIHRACGQIVSCSDITALAARDSVFLSGGPDYRVPLGRRDGLTFATRDATLENLPFFGSTARELIASVATKGFDATDLVAISGGHTIGRGNCGSFTARLYPNQDVNMDQTYAKNLKRICPALNSNGTTVLDIRTPNIFDNRYYVDLMNRQGLFMSDQDLYTDRTTRPIVTSFAINQTLFYERFAFSMIKIGMLDVLTGTQGEVRADCSRRNAARTYVTTLVDDQEGEIASF*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTTCTTCTGCTTCATTCATCTCCCTACTTTTTCTTTCTTCTCTTATCCTTGGTTCTCATTTGTCTCTAACAAGAGCACAACCCACACCACCTTTAGTTGGGGGTCTTTCATGGACA
TTCCATAGAACAAACTGTCCTAATTTGGAAACCATTGTTAGAGACTACCTTAGACAGGTTTTTAGGGATGATATTGGTCAAGCTGCAGGCTTGCTTCGTATTCACTTCCATGACTGCTTC
GTTCAG
GTACTTGCCACTATATTTGCATTTTATTGATGATATATTAAATTGGGTCCAGTATCAAGTAAAACTTCCTCATGGATGGCTATTGTTCTGTTTAAATTAGTTGAAGCAAACATA
CGTAGATCCAAAAGTTTTGTTTGCCTGGATTCAGGTTACAAATATGACTGATCTCATGTGTTATACAGTTATACTAATGTTGGTCTTGGTGTATGTACTTATATGTGCAGGGATGTGATG
GCTCAGTGTTGCTAGCTGGGTCAGCAAGTGGTCCAGGAGAACAGGAAGCACCACCAAACTTGACACTCAGACCCCAGGCATTTACTATCATTAACGAACTCCGCAACCGCATCCATAGAG
CTTGCGGTCAAATCGTTTCTTGTTCAGACATTACTGCTCTGGCTGCTCGTGATTCTGTTTTTCTG
GTACAAATTCCTTCCCAGTCTTAATTTTTGGGCTCAAACATCTAGTCTTCTATAA
ACTTCATGCTACACACTAGTAAAATTGACATGAGAAGGTTGTATGCAAACTAATTAAATCATGGTCATGCAGTCAGGAGGTCCGGATTACAGAGTTCCATTGGGCAGGCGTGATGGGCTC
ACTTTTGCAACAAGAGATGCAACACTCGAAAACCTTCCATTTTTCGGTTCAACTGCAAGGGAGCTCATTGCTTCTGTTGCCACCAAGGGCTTCGATGCAACCGATCTAGTAGCCATCTCT
GGTGGTCACACCATTGGCCGTGGCAATTGTGGGTCATTCACTGCACGTTTATACCCCAACCAGGATGTAAACATGGACCAAACATATGCGAAAAACCTTAAACGCATATGCCCTGCACTC
AATTCAAATGGCACCACTGTGTTAGATATTCGAACTCCAAACATATTTGACAACAGATACTATGTGGATCTTATGAATCGGCAAGGTCTCTTCATGTCAGACCAAGACTTGTACACTGAT
AGAACTACTAGACCTATTGTCACAAGTTTTGCCATCAATCAAACCCTATTCTATGAAAGGTTTGCATTTTCCATGATTAAGATTGGTATGTTGGATGTGTTAACTGGGACACAAGGTGAG
GTACGTGCTGATTGTTCACGTCGCAATGCTGCTAGGACATATGTGACCACTCTGGTGGATGATCAAGAAGGGGAGATTGCATCATTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTTCTTCTGCTTCATTCATCTCCCTACTTTTTCTTTCTTCTCTTATCCTTGGTTCTCATTTGTCTCTAACAAGAGCACAACCCACACCACCTTTAGTTGGGGGTCTTTCATGGACA
TTCCATAGAACAAACTGTCCTAATTTGGAAACCATTGTTAGAGACTACCTTAGACAGGTTTTTAGGGATGATATTGGTCAAGCTGCAGGCTTGCTTCGTATTCACTTCCATGACTGCTTC
GTTCAG
GGATGTGATGGCTCAGTGTTGCTAGCTGGGTCAGCAAGTGGTCCAGGAGAACAGGAAGCACCACCAAACTTGACACTCAGACCCCAGGCATTTACTATCATTAACGAACTCCGC
AACCGCATCCATAGAGCTTGCGGTCAAATCGTTTCTTGTTCAGACATTACTGCTCTGGCTGCTCGTGATTCTGTTTTTCTG
TCAGGAGGTCCGGATTACAGAGTTCCATTGGGCAGGCGT
GATGGGCTCACTTTTGCAACAAGAGATGCAACACTCGAAAACCTTCCATTTTTCGGTTCAACTGCAAGGGAGCTCATTGCTTCTGTTGCCACCAAGGGCTTCGATGCAACCGATCTAGTA
GCCATCTCTGGTGGTCACACCATTGGCCGTGGCAATTGTGGGTCATTCACTGCACGTTTATACCCCAACCAGGATGTAAACATGGACCAAACATATGCGAAAAACCTTAAACGCATATGC
CCTGCACTCAATTCAAATGGCACCACTGTGTTAGATATTCGAACTCCAAACATATTTGACAACAGATACTATGTGGATCTTATGAATCGGCAAGGTCTCTTCATGTCAGACCAAGACTTG
TACACTGATAGAACTACTAGACCTATTGTCACAAGTTTTGCCATCAATCAAACCCTATTCTATGAAAGGTTTGCATTTTCCATGATTAAGATTGGTATGTTGGATGTGTTAACTGGGACA
CAAGGTGAGGTACGTGCTGATTGTTCACGTCGCAATGCTGCTAGGACATATGTGACCACTCTGGTGGATGATCAAGAAGGGGAGATTGCATCATTTTGA

Retrieve as FASTA