Entry information : AcoPrx14 (AcoGoldSmith_v1.007746m)
Entry ID 8578
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-14 (Qiang Li)
Peroxidase information: AcoPrx14 (AcoGoldSmith_v1.007746m)
Name (synonym) AcoPrx14 (AcoGoldSmith_v1.007746m)
Class Class III peroxidase    [Orthogroup: Prx029]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx14
start..stop
S start..stop
MePrx10 529 0 17..346 18..347
RcPrx49 528 0 12..346 16..352
CroPrx51 524 0 5..347 1..352
PtPrx07 520 0 19..346 15..344
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1423496..1423759 264 N° 2 1424012..1424212 201 N° 3 1426162..1426743 582  
join(1423496..1423759,1424012..1424212,1426162..1426743)


exon

Literature and cross-references AcoPrx14 (AcoGoldSmith_v1.007746m)
DNA ref. Phytozome 12:   scaffold_5 (1423496..1426743)
Protein sequence: AcoPrx14 (AcoGoldSmith_v1.007746m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   349 (317)
PWM (Da):   %s   38390.47 (34822.7)  
PI (pH):   %s   9.18 (9.18) Peptide Signal:   %s   cut: 32 range:32-348
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSMSMFMQSSFFTNSTLIILLLVMLIGTSQSSSANTTTHRHPLKLDFYSKSCPHVEQLVGAVTSQQFKESPVSAPATIRLFFHDCFVQGCDASILISTKPGSKALAEKDAQDNKHLAVEAFDTIKKAKALIESKCPGVVSCADILAIAARDFVHLAGGPYYQVKTGRWDGKISMASKVSYNIPRANSTIDELLKLFASKGLSLQDLVALSGAHTIGFSHCEHFVRRLYDYRGTKKADPAMDPRLQKALKMSCSQYGGNPEVVVPFDVSTPFTFDHAYYGNLENNMGLLATDQALFLDPRTRPIVQALGSNKQKFFQAFSEAMDKMGSIEVKRGKKHGERRKECSQHLQ*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCATGTCCATGTTTATGCAAAGCTCTTTCTTCACTAATAGTACTCTTATTATTCTTCTTCTTGTTATGCTAATAGGGACCTCTCAGTCTTCATCTGCTAACACCACCACTCATCGT
CACCCACTCAAACTAGACTTCTACTCTAAATCTTGCCCACATGTCGAACAACTTGTCGGAGCTGTCACCTCTCAACAATTCAAAGAATCACCCGTTTCTGCACCAGCAACAATTCGTCTC
TTCTTCCATGACTGCTTTGTCCAA
GTAATCTATCTAACATTTCTATCAACGGTGCATTTTAGCATTTTCTTATCAACTGAAGCTAACATTCACAAGTGGTCCCGTGAAGATAGCTTCACC
ACAATTGAGACATAATAGTGTTCCTGAATTCTGACCATAATACACACTTTGCGCCGTTTTAAAAACATCACAAAAGTACAAGTGTCATTCCAGTGCATGTTAGCAAAGGCCCACAGTAAT
CAAAACTGATACAATGTTCTTGTTGTTTGATTACAGGGTTGTGATGCCTCAATTCTGATCTCGACCAAGCCAGGGAGTAAAGCATTGGCAGAAAAGGATGCGCAGGATAACAAGCATTTA
GCTGTCGAGGCATTTGATACCATAAAGAAGGCTAAGGCCTTGATAGAGAGCAAGTGCCCTGGTGTAGTTTCGTGTGCTGACATTTTGGCCATTGCAGCCAGAGATTTCGTTCACTTG
GTA
TTTATCTTCTACATTTTTTTTCGTTACAAAATTTACTTTGGAGTAACAAGTCGTACTTCCAAACTAAACACAAATAAACCATAGCATTTCTTCCATATAGGTAGAGAGCAAGTGCCCTGC
TGTAGTATTCAACATTGTCCATAATTTTTCTATTGAATCTGGCTCTGGCAGTTTGTGAAAATGGTTTTTCATGTAAGAGTGTTGTCATTTTCAGGTAGAAAACATCCAAAACCACACAAA
TTCCCAACAATAATAGGATTATCATGTTCTATGTAAAAAGGACAGTACAGTTAGTATGTCCAAACAGATTGTTCTTTTGTTCCTAAACAGCTTCAAGACACTAAAATGCTTCCAGTCTGG
TTACACTTGAACGGTTTATGTTGTCGTGACGCACTTTGACATCAAGTTAAACTGCCAAAGGAAGATTTACTAATGGATTCTTTCTAGGAATTAAGTAAATCATACTGTTCTGAGTCAAAA
AAACGTTCAAGTTCTGGGCATCTTAGTAACGAAGACCTTCCTCGACTACAAGGAAATTAGTCATTTAAACGAATTTCATCAAAAACGGCTTTCAACTTATAAGCTAAAGTTTCCCTCAGG
AAAACACTCCTACCACCTCTTGCGACCCACCCACATGATTCCAGATGGAATATGCAGGATGACCATACACTGGAATAGTGCGCCAAAGAACTACTACACAAGAACTATCCTGTGAGTGAA
CTATAGAAGGTGACTTAGGGGAGCCCAAAGATGAACGGCATTCAGACAAATTAATGACACTGACTTCCACTATATTAGAAACAACGCCTAGAATAGACAGAGCTAAAGTGGCCCTGTAAC
ATCTAATCACGACCGTCAAGATCGGTTATCCCTAAAAAAAAGACCAACAGCTTATCAACGGCCTTTAGAATGGGGCATAACTGAATGGACTTACAACTAAAGTAGTAACGAACTGCTGCC
TCAATCAATTGCCAAATCAAGAGCGCGGTCCAAGCAAACAGACGTCCCTATGCAGAGATTAAAAGGTTAAGGGAAACATGCTGGTCATATAACCTGTGAGGCCGTGACCATGCAAGTCCT
TTGGCTGACTGCAAGATCACTGTAACAATAATGACTAAATCATAGACCTCAGTAGCTTGTGCGCTGCCCCTGATCGTAAGAGTCCAAATGTACTGGTATCAAAAACTTGACATTAACAAC
ACCTATCCCAGAGCCCAATGAGTAAAATAAAAGCACTTGCTGGTACTTAAATAATCCTGCAAAGTGCAAACCAAACCCACAAAAGAAAAATTATGCACCGAGACCACAAAGCTGGACCCA
TGGAGGGGCTTTGTTCAGATTTTGTACAAGCCACAACTAATGCTGATTCCAGATGCAAAAGGTCTGTTGTCTGTCACAAAGGCAATGACTGCAGTAAATGTATCTGACTCTAAGCTATAT
ATGTTAAATCGACCTCTCGCTTTAAAGCCTTCTCTATGCACTACTAAGCCATGTAGCTGGCTCTTTACCAATGCATTTGCATATAGTCACAAGAAAATTCCCTTTGTGGTCCATGAACTT
ATCCCTATATCCAACCTGAGCAGGATTGCCTTTGGAGCATCCACCAACATTAATTTCAATTATATCTCTGAGCTGGCAGTGATCACTGGGCACTGGCATGTCTTGAGCTGTGGAGCTTTC
TATTTGCTTCTATTCTATACCATCCAGTCCTTCAGGACCATGAAGTCAAGTATTGTGTAGTGCATTGCTTCGGAAATGTAGTTCGTGTTGTGGGACCTATTGTAGATGTTTTTGCAATAG
GATAGTCAGCATCATAGACGCCCTCGAGCCACTAATCATACATCCGTAATCCAAAATTTACTAACATTCGCATTTTGATCTTTGTGGATGACGACTGTTACTCTTCTTTGAGGAATACTG
AGGCTAGTGTCATATCTATGTTGCAGGCAGGAGGACCATACTATCAAGTGAAAACAGGAAGGTGGGATGGCAAAATTTCAATGGCATCGAAAGTGAGCTATAACATTCCACGAGCTAATT
CCACTATTGACGAGCTCCTAAAGCTTTTTGCCTCCAAAGGGCTAAGCCTACAAGATTTAGTGGCTCTTTCAGGTGCCCACACAATTGGTTTCTCTCATTGTGAACATTTTGTAAGACGAC
TCTATGACTATCGAGGCACTAAGAAAGCAGACCCAGCCATGGATCCAAGGCTCCAAAAGGCCCTAAAAATGTCTTGCTCTCAGTATGGTGGTAATCCTGAAGTGGTTGTACCATTTGATG
TTTCGACACCATTCACATTCGATCACGCATATTATGGAAATTTAGAAAACAACATGGGGTTACTAGCCACAGACCAAGCTCTTTTCTTGGACCCAAGAACTCGACCCATTGTTCAGGCTC
TAGGAAGTAATAAGCAGAAGTTTTTTCAGGCCTTCTCAGAGGCAATGGACAAAATGGGCTCTATAGAGGTAAAGAGAGGGAAAAAACATGGGGAGAGAAGAAAGGAATGTAGTCAGCACT
TGCAATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCATGTCCATGTTTATGCAAAGCTCTTTCTTCACTAATAGTACTCTTATTATTCTTCTTCTTGTTATGCTAATAGGGACCTCTCAGTCTTCATCTGCTAACACCACCACTCATCGT
CACCCACTCAAACTAGACTTCTACTCTAAATCTTGCCCACATGTCGAACAACTTGTCGGAGCTGTCACCTCTCAACAATTCAAAGAATCACCCGTTTCTGCACCAGCAACAATTCGTCTC
TTCTTCCATGACTGCTTTGTCCAA
GGTTGTGATGCCTCAATTCTGATCTCGACCAAGCCAGGGAGTAAAGCATTGGCAGAAAAGGATGCGCAGGATAACAAGCATTTAGCTGTCGAGGCA
TTTGATACCATAAAGAAGGCTAAGGCCTTGATAGAGAGCAAGTGCCCTGGTGTAGTTTCGTGTGCTGACATTTTGGCCATTGCAGCCAGAGATTTCGTTCACTTG
GCAGGAGGACCATAC
TATCAAGTGAAAACAGGAAGGTGGGATGGCAAAATTTCAATGGCATCGAAAGTGAGCTATAACATTCCACGAGCTAATTCCACTATTGACGAGCTCCTAAAGCTTTTTGCCTCCAAAGGG
CTAAGCCTACAAGATTTAGTGGCTCTTTCAGGTGCCCACACAATTGGTTTCTCTCATTGTGAACATTTTGTAAGACGACTCTATGACTATCGAGGCACTAAGAAAGCAGACCCAGCCATG
GATCCAAGGCTCCAAAAGGCCCTAAAAATGTCTTGCTCTCAGTATGGTGGTAATCCTGAAGTGGTTGTACCATTTGATGTTTCGACACCATTCACATTCGATCACGCATATTATGGAAAT
TTAGAAAACAACATGGGGTTACTAGCCACAGACCAAGCTCTTTTCTTGGACCCAAGAACTCGACCCATTGTTCAGGCTCTAGGAAGTAATAAGCAGAAGTTTTTTCAGGCCTTCTCAGAG
GCAATGGACAAAATGGGCTCTATAGAGGTAAAGAGAGGGAAAAAACATGGGGAGAGAAGAAAGGAATGTAGTCAGCACTTGCAATAG

Retrieve as FASTA