Entry information : AcoPrx17 (AcoGoldSmith_v1.007924m)
Entry ID 8580
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-14 (Qiang Li)
Peroxidase information: AcoPrx17 (AcoGoldSmith_v1.007924m)
Name (synonym) AcoPrx17 (AcoGoldSmith_v1.007924m)
Class Class III peroxidase    [Orthogroup: Prx025]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx17
start..stop
S start..stop
AfpPrx21 706 0 1..342 1..342
MtPrx40 537 0 31..342 27..338
VvPrx48 528 0 35..342 32..339
PtPrx95 523 0 9..342 11..340
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7612034..7612279 246 N° 2 7612480..7612671 192 N° 3 7612786..7612951 166 N° 4 7613140..7613564 425
join(7612034..7612279,7612480..7612671,7612786..7612951,7613140..7613564)


exon

Literature and cross-references AcoPrx17 (AcoGoldSmith_v1.007924m)
DNA ref. Phytozome 12:   scaffold_2 (7612034..7613564)
Protein sequence: AcoPrx17 (AcoGoldSmith_v1.007924m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   343
PWM (Da):   %s   37143.76 Transmb domain:   %s   i12-34o
PI (pH):   %s   6.39
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVHSKYSKPSFLRSLALVLSILSLLINVLSYGTVPPLTLDYYSSSCPTALDIVRKEMECAVLSEPRMAASVLRLHFHDCFVQGCDGSILLDDTITLQGEKKASTNIHSLRGFGVIDRIKNKLESECPGIVSCADLLTIAARDAVILVGGPYWDVPLGRKDSTTASSTLASSNLPTAGQGLFSLVSSFLYQGLTVTDMVALVGAHTIGMARCQNFRERIYGDYEATSNKNPVSDTQLNHLKSICPATGGGGNNVTAMDYVTPNLFDNSFYHLLLKGEGLLNSDQEMYSSLLGVETKKLVQKYAEDVVAFFQQFSDSMVKLGNITNSESSVTGEVRKNCRFVNT*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGCATTCCAAGTATTCAAAACCCTCTTTTCTCCGTTCTCTAGCCTTAGTTTTATCAATTTTAAGCCTGTTGATCAATGTTCTCTCTTATGGAACAGTCCCTCCATTAACATTGGAT
TACTATTCATCTTCATGTCCAACTGCACTAGATATTGTCAGAAAAGAAATGGAATGTGCTGTTCTCTCTGAACCACGCATGGCTGCATCCGTACTTAGGTTGCATTTTCATGATTGTTTT
GTTCAG
GTTAGTATATACTGCAGTAGTGCAGTTGTATATATAACTTAATGACTACATTGTGGTAATTAATGGAAAAATATATAAGAAATTCAGTTATCACTAAGTATTGTACGTATGTTG
GTAATTAATGGCCAATTACAGGTTCTCAGTGGCAATATTTATAACAAGATTTCCATCCCAATATCTGTTTTTTGTTATGTTCACAGGGTTGTGATGGATCAATTTTACTAGATGACACAA
TCACACTACAAGGAGAGAAGAAGGCATCAACTAATATTCACTCTTTGAGAGGCTTCGGGGTGATTGACAGGATAAAAAACAAGCTTGAATCCGAATGCCCAGGAATTGTTTCTTGTGCAG
ATTTACTCACCATCGCAGCAAGAGATGCAGTAATTCTG
GTACGAAATGTACCATTAAATCTGCAACAACCATGTTGAGACATCAAAGTTTCTACTCAAATGTTGTGTTTTCGCTCTTTAA
AATATAATTATGAGATACTTTGATGCTTGAAGGTTGGAGGACCATACTGGGATGTTCCACTGGGGAGAAAGGATTCCACAACTGCAAGTTCTACTCTAGCGAGCTCAAATCTTCCTACTG
CTGGTCAAGGCCTTTTCAGTCTTGTTTCTAGCTTTCTGTATCAAGGCCTAACAGTCACAGATATGGTGGCTCTAGTAG
GTAATATACCTTTAGATCAAATAATCTTTGATTTTGCATTAT
CTGACGATGTTGACACTAAACGTATTGAAATTTTGATTGGCATCTGGTAGAAAATTTTACGATAAAAACAAGTTTCGTGTGCAAATATTTTGGAGTTTTGTAATATAAGAATGGATTTGA
TGTTACAACAACGGTTTAATGTACAGGTGCACACACCATAGGCATGGCTCGGTGCCAGAATTTTCGGGAAAGGATTTATGGAGACTATGAGGCGACTAGCAACAAAAATCCTGTCAGTGA
CACACAACTCAACCATCTGAAATCTATCTGTCCAGCTACTGGGGGTGGAGGAAACAATGTCACTGCAATGGACTATGTTACACCTAACCTTTTCGACAATTCTTTCTATCACTTACTTCT
GAAAGGGGAGGGCTTACTGAACTCTGACCAGGAAATGTATTCTAGCCTATTGGGGGTCGAGACAAAGAAGCTTGTTCAGAAGTATGCAGAAGATGTAGTCGCTTTCTTTCAACAGTTTTC
TGATTCCATGGTGAAGCTGGGAAATATTACTAATAGTGAAAGCTCTGTTACTGGGGAAGTAAGAAAGAACTGCAGATTTGTGAACACATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGCATTCCAAGTATTCAAAACCCTCTTTTCTCCGTTCTCTAGCCTTAGTTTTATCAATTTTAAGCCTGTTGATCAATGTTCTCTCTTATGGAACAGTCCCTCCATTAACATTGGAT
TACTATTCATCTTCATGTCCAACTGCACTAGATATTGTCAGAAAAGAAATGGAATGTGCTGTTCTCTCTGAACCACGCATGGCTGCATCCGTACTTAGGTTGCATTTTCATGATTGTTTT
GTTCAG
GGTTGTGATGGATCAATTTTACTAGATGACACAATCACACTACAAGGAGAGAAGAAGGCATCAACTAATATTCACTCTTTGAGAGGCTTCGGGGTGATTGACAGGATAAAAAAC
AAGCTTGAATCCGAATGCCCAGGAATTGTTTCTTGTGCAGATTTACTCACCATCGCAGCAAGAGATGCAGTAATTCTG
GTTGGAGGACCATACTGGGATGTTCCACTGGGGAGAAAGGAT
TCCACAACTGCAAGTTCTACTCTAGCGAGCTCAAATCTTCCTACTGCTGGTCAAGGCCTTTTCAGTCTTGTTTCTAGCTTTCTGTATCAAGGCCTAACAGTCACAGATATGGTGGCTCTA
GTAG
GTGCACACACCATAGGCATGGCTCGGTGCCAGAATTTTCGGGAAAGGATTTATGGAGACTATGAGGCGACTAGCAACAAAAATCCTGTCAGTGACACACAACTCAACCATCTGAAA
TCTATCTGTCCAGCTACTGGGGGTGGAGGAAACAATGTCACTGCAATGGACTATGTTACACCTAACCTTTTCGACAATTCTTTCTATCACTTACTTCTGAAAGGGGAGGGCTTACTGAAC
TCTGACCAGGAAATGTATTCTAGCCTATTGGGGGTCGAGACAAAGAAGCTTGTTCAGAAGTATGCAGAAGATGTAGTCGCTTTCTTTCAACAGTTTTCTGATTCCATGGTGAAGCTGGGA
AATATTACTAATAGTGAAAGCTCTGTTACTGGGGAAGTAAGAAAGAACTGCAGATTTGTGAACACATGA

Retrieve as FASTA