Entry information : AcoPrx28 (AcoGoldSmith_v1.008374m)
Entry ID 8585
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-10-15 (Christophe Dunand)
Peroxidase information: AcoPrx28 (AcoGoldSmith_v1.008374m)
Name (synonym) AcoPrx28 (AcoGoldSmith_v1.008374m)
Class Class III peroxidase    [Orthogroup: Prx222]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx28
start..stop
S start..stop
AcoPrx86 604 0 1..326 1..327
AfpPrx03 516 0 1..326 1..325
AcoPrx30 514 0 1..326 1..325
PtrtrPrx05 462 1e-165 2..326 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 51422..51634 213 N° 2 50863..51054 192 N° 3 50591..50753 163 N° 4 50075..50490 416
complement(join(50075..50490,50591..50753,50863..51054,51422..51634))


exon

Literature and cross-references AcoPrx28 (AcoGoldSmith_v1.008374m)
DNA ref. Phytozome 12:   scaffold_15 (51634..50075)
Protein sequence: AcoPrx28 (AcoGoldSmith_v1.008374m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (303)
PWM (Da):   %s   35779.52 (33129.0) Transmb domain:   %s   i7-24o
PI (pH):   %s   8.68 (8.38) Peptide Signal:   %s   cut: 25 range:25-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGKKTCFGKIILCVLAFLIGSTVADLKLGFYEKSCPNAEKIVLAHVKKHIPNVPTLAAPLLRMTFHDCFVRGCDASVLLNDTSNNQAERNARPNLSLRGYDFIDEVKSLLEAECPGIVSCADIISLVARDSVVTTGGPYWKVPTGRRDGTISRASEALNNLPGANENFNALKTKFELKGLNIKDLVLLSGAHTIGITHCNTFTNRIYNFTGIGDQDPALDNDYAVNLRANKCKTPTDSTTIVEMDPSSSKNFDLSYYKLLVKRRGLFQSDATLITDSSSIAVINQLLKKSPLYFFAEFAKSMEKMGAIGVKIGTDGQIRKHCALVNR*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAAGAAGACTTGTTTTGGGAAAATAATTTTGTGTGTTCTGGCTTTCTTAATTGGTTCAACAGTTGCTGATTTGAAGTTAGGTTTTTATGAAAAAAGTTGTCCAAATGCTGAAAAG
ATTGTGTTGGCCCATGTAAAGAAGCATATCCCAAATGTCCCAACTTTGGCTGCACCATTACTTAGAATGACCTTCCATGACTGCTTTGTGAGG
GTTAGTATTTCCTTGGCTTCTGTATTA
CACTGCTGCTATCTATATATTTGTGAGGGAATGAAAATTTAATCTTTTCATATTTTATAAACTATTTAGCTATATAATTTCTTTTATTTGTTTAAAAGAAGAAAGTTATATCAAAAATTA
TAATTGCAGCACTGTCATGTAGCATATAGTAGCATATATAATTATATATTACTTAGCTCGATATCATTCTTACAGAAACTAAAGCATCCCTTGGGTTGAATGGGGTTGTAATGGATCATA
GTTATTTGTGTAATTTGTCCTTCATTTATGCTTTGTATTTTATCAAACTATAAATGTATGACATTTTGTAAATATAACAAAATATTCTTGTTAATTTTAGGGTTGTGATGCTTCTGTCCT
CCTAAACGATACTTCAAACAACCAGGCTGAGAGGAATGCTCGTCCAAATCTATCCCTTCGAGGCTATGATTTCATTGATGAAGTGAAGAGCTTATTAGAAGCTGAATGTCCTGGCATTGT
TTCATGTGCAGACATTATCTCTTTGGTTGCAAGGGATTCAGTTGTTACTACC
GTAAGGATAGTTAATCTAAGTGAACATAGTTTTATCTTTCGTTACTTCAATAAATCTATTTCAAGATG
AAATGCAATATTTAACATTCATTGTTCAATCAAATCAATAGGGAGGTCCATATTGGAAAGTCCCAACGGGTCGTAGAGATGGGACTATATCAAGAGCCTCAGAAGCCTTGAACAACCTCC
CTGGAGCAAATGAAAACTTCAATGCCCTCAAGACAAAATTTGAGCTCAAAGGACTTAACATAAAAGATCTTGTTCTATTGTCTG
GTATTTTTTTTATAACAATCTACTCTCATACATTAT
TATTTTTATCCAGAAAATTTGTATATAACTAACACCTTTCTTCAATATAATTATGTCTCTTCAGGTGCTCACACAATTGGGATCACTCATTGTAATACATTTACGAATCGTATATACAAT
TTCACAGGGATAGGAGATCAAGATCCTGCTTTGGACAATGATTATGCTGTAAATTTGAGAGCAAATAAGTGTAAAACTCCTACTGATAGCACAACAATAGTTGAGATGGATCCAAGTAGT
TCAAAGAATTTTGACCTTAGTTATTACAAACTTTTGGTTAAAAGACGAGGTCTATTTCAGTCAGATGCAACTCTTATCACTGACTCCAGTTCAATAGCTGTTATCAACCAACTTCTCAAG
AAATCACCATTATATTTTTTTGCGGAGTTTGCTAAATCGATGGAGAAGATGGGTGCTATTGGTGTGAAGATTGGAACAGATGGTCAGATAAGAAAACATTGTGCACTAGTGAATAGATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAAGAAGACTTGTTTTGGGAAAATAATTTTGTGTGTTCTGGCTTTCTTAATTGGTTCAACAGTTGCTGATTTGAAGTTAGGTTTTTATGAAAAAAGTTGTCCAAATGCTGAAAAG
ATTGTGTTGGCCCATGTAAAGAAGCATATCCCAAATGTCCCAACTTTGGCTGCACCATTACTTAGAATGACCTTCCATGACTGCTTTGTGAGG
GGTTGTGATGCTTCTGTCCTCCTAAAC
GATACTTCAAACAACCAGGCTGAGAGGAATGCTCGTCCAAATCTATCCCTTCGAGGCTATGATTTCATTGATGAAGTGAAGAGCTTATTAGAAGCTGAATGTCCTGGCATTGTTTCATGT
GCAGACATTATCTCTTTGGTTGCAAGGGATTCAGTTGTTACTACC
GGAGGTCCATATTGGAAAGTCCCAACGGGTCGTAGAGATGGGACTATATCAAGAGCCTCAGAAGCCTTGAACAAC
CTCCCTGGAGCAAATGAAAACTTCAATGCCCTCAAGACAAAATTTGAGCTCAAAGGACTTAACATAAAAGATCTTGTTCTATTGTCTG
GTGCTCACACAATTGGGATCACTCATTGTAAT
ACATTTACGAATCGTATATACAATTTCACAGGGATAGGAGATCAAGATCCTGCTTTGGACAATGATTATGCTGTAAATTTGAGAGCAAATAAGTGTAAAACTCCTACTGATAGCACAACA
ATAGTTGAGATGGATCCAAGTAGTTCAAAGAATTTTGACCTTAGTTATTACAAACTTTTGGTTAAAAGACGAGGTCTATTTCAGTCAGATGCAACTCTTATCACTGACTCCAGTTCAATA
GCTGTTATCAACCAACTTCTCAAGAAATCACCATTATATTTTTTTGCGGAGTTTGCTAAATCGATGGAGAAGATGGGTGCTATTGGTGTGAAGATTGGAACAGATGGTCAGATAAGAAAA
CATTGTGCACTAGTGAATAGATAA

Retrieve as FASTA