Entry information : AcoPrx29 (AcoGoldSmith_v1.008383m)
Entry ID 8586
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-14 (Qiang Li)
Peroxidase information: AcoPrx29 (AcoGoldSmith_v1.008383m)
Name (synonym) AcoPrx29 (AcoGoldSmith_v1.008383m)
Class Class III peroxidase    [Orthogroup: Prx194]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx29
start..stop
S start..stop
AfpPrx28 670 0 1..327 1..327
AcoPrx84 662 0 2..327 1..326
PtPrx89 311 7e-106 5..326 11..328
GbPrx44 310 2e-105 8..326 13..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2625351..2625569 219 N° 2 2625056..2625247 192 N° 3 2624792..2624960 169 N° 4 2624299..2624702 404
complement(join(2624299..2624702,2624792..2624960,2625056..2625247,2625351..2625 569))


exon

Literature and cross-references AcoPrx29 (AcoGoldSmith_v1.008383m)
DNA ref. Phytozome 12:   scaffold_7 (2625569..2624299)
Protein sequence: AcoPrx29 (AcoGoldSmith_v1.008383m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (305)
PWM (Da):   %s   36244.75 (33718.4)  
PI (pH):   %s   8.95 (9.06) Peptide Signal:   %s   cut: 23 range:23-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMKFLAILCLVSLVFFISDVGAKKDGLKRDYYKKTSCPQAEEVVAKMMKDIVTDDFRVAPRILRMHFHDCFVRGCEGSILLNSTSTDKAEKEARPNNPSLKGFDVIDRIKAELEKQCPKVVSCADILAYAARESVKLTGKCRAYAVRGGRKDGLISREIEALQNLPPPSANVSTLIKSFASKGLSLQEMVTLSGGHSIGRSFCAAILGRHNNFNNTGKPDPTLNSDLAAKLRKQCVALTDLVDMDTITPNTLDNKYYRGLLENKGLFTSDAALLTNKETLKEVKSNDFLPSAYWENKFVKAMIKMGEIDVLTGHEGQIREKCYVVNK*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGAAGTTTCTTGCAATTCTTTGCCTAGTTTCCCTGGTGTTTTTCATATCAGATGTGGGAGCTAAAAAGGATGGTTTAAAACGTGATTACTACAAAAAAACATCATGTCCACAAGCC
GAGGAAGTTGTCGCTAAGATGATGAAAGATATTGTTACAGATGATTTCAGGGTTGCTCCTAGGATACTAAGGATGCATTTCCATGATTGTTTTGTAAGG
GTATGTATTGCATCAATGAAC
TTCCAATACCGAGGTTAATTTAGAGTGTAATAAAACAATAAGCATGTCTTACATTTTGTGTTTTACGTCTGTTTTCTCGCAGGGATGTGAGGGATCGATCCTCCTTAACTCTACATCAAC
TGACAAGGCAGAGAAAGAGGCACGTCCTAATAATCCTAGTCTTAAAGGCTTTGATGTGATTGATCGAATTAAAGCAGAATTGGAAAAGCAATGTCCCAAGGTTGTATCATGCGCTGACAT
TCTTGCCTACGCAGCTAGAGAGAGTGTTAAACTG
GTAGGTATATATATGAAGTATGAAGATGAACACTTGACTTAACAACTCCATTAAAATTGTGATTCTCACTGATCTTTTTGCTTGGC
GACAATTAGACTGGTAAGTGCAGGGCTTATGCTGTTCGAGGAGGACGTAAAGATGGTCTGATTTCTAGAGAGATAGAAGCACTCCAAAATCTCCCACCACCTTCTGCTAACGTCAGTACA
CTTATAAAAAGTTTTGCTTCTAAGGGCTTATCACTTCAAGAAATGGTAACCCTCTCAG
GTAATGCAAGCGAATGAAGAACTCTTTACAATATATGTTCCTAGCCTTTCTAAACCTAAGAA
ATTATCAAATTGTTGTGTCGTTTGTAGGAGGACATTCCATAGGTCGTTCATTTTGTGCTGCGATCTTAGGAAGACATAACAACTTCAACAACACTGGAAAACCAGATCCCACTCTCAATA
GCGATCTGGCTGCAAAATTAAGAAAACAATGTGTCGCTTTAACTGACTTGGTTGACATGGACACAATTACACCTAACACTCTAGATAACAAATATTACAGAGGTTTGTTGGAGAACAAAG
GCTTATTTACATCGGACGCAGCTTTGCTCACCAATAAGGAAACTTTAAAAGAAGTTAAAAGCAATGATTTTCTACCATCAGCTTATTGGGAGAATAAGTTTGTTAAGGCAATGATCAAAA
TGGGAGAAATAGATGTTCTAACTGGACATGAAGGACAGATCAGAGAAAAGTGTTACGTCGTAAATAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGAAGTTTCTTGCAATTCTTTGCCTAGTTTCCCTGGTGTTTTTCATATCAGATGTGGGAGCTAAAAAGGATGGTTTAAAACGTGATTACTACAAAAAAACATCATGTCCACAAGCC
GAGGAAGTTGTCGCTAAGATGATGAAAGATATTGTTACAGATGATTTCAGGGTTGCTCCTAGGATACTAAGGATGCATTTCCATGATTGTTTTGTAAGG
GGATGTGAGGGATCGATCCTC
CTTAACTCTACATCAACTGACAAGGCAGAGAAAGAGGCACGTCCTAATAATCCTAGTCTTAAAGGCTTTGATGTGATTGATCGAATTAAAGCAGAATTGGAAAAGCAATGTCCCAAGGTT
GTATCATGCGCTGACATTCTTGCCTACGCAGCTAGAGAGAGTGTTAAACTG
ACTGGTAAGTGCAGGGCTTATGCTGTTCGAGGAGGACGTAAAGATGGTCTGATTTCTAGAGAGATAGAA
GCACTCCAAAATCTCCCACCACCTTCTGCTAACGTCAGTACACTTATAAAAAGTTTTGCTTCTAAGGGCTTATCACTTCAAGAAATGGTAACCCTCTCAG
GAGGACATTCCATAGGTCGT
TCATTTTGTGCTGCGATCTTAGGAAGACATAACAACTTCAACAACACTGGAAAACCAGATCCCACTCTCAATAGCGATCTGGCTGCAAAATTAAGAAAACAATGTGTCGCTTTAACTGAC
TTGGTTGACATGGACACAATTACACCTAACACTCTAGATAACAAATATTACAGAGGTTTGTTGGAGAACAAAGGCTTATTTACATCGGACGCAGCTTTGCTCACCAATAAGGAAACTTTA
AAAGAAGTTAAAAGCAATGATTTTCTACCATCAGCTTATTGGGAGAATAAGTTTGTTAAGGCAATGATCAAAATGGGAGAAATAGATGTTCTAACTGGACATGAAGGACAGATCAGAGAA
AAGTGTTACGTCGTAAATAAGTAA

Retrieve as FASTA