Entry information : AcoPrx32 (AcoGoldSmith_v1.008417m)
Entry ID 8589
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-14 (Qiang Li)
Peroxidase information: AcoPrx32 (AcoGoldSmith_v1.008417m)
Name (synonym) AcoPrx32 (AcoGoldSmith_v1.008417m)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx32
start..stop
S start..stop
AcoPrx116 672 0 1..326 1..326
AcoPrx115 667 0 1..326 1..326
CmicPrx01 516 0 1..326 1..325
MePrx88 512 0 8..326 2..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1998786..1999001 216 N° 2 1999185..1999376 192 N° 3 1999474..1999639 166 N° 4 1999763..2000169 407
join(1998786..1999001,1999185..1999376,1999474..1999639,1999763..2000169)


exon

Literature and cross-references AcoPrx32 (AcoGoldSmith_v1.008417m)
DNA ref. Phytozome 11:   scaffold_17 (1998786..2000169)
Protein sequence: AcoPrx32 (AcoGoldSmith_v1.008417m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (302)
PWM (Da):   %s   35610.81 (32883.4) Transmb domain:   %s   i5-27o
PI (pH):   %s   7.91 (8.00) Peptide Signal:   %s   cut: 25 range:25-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRTSFFDFLLVCLVLFGVAGICHAGELRKNFYEDSCPQAEEVIKNIIWKHVASNSALPAKFLRMHFHDCFVRGCDASLLLNSTANNKAEKEAVPNLSVSGFDVIDEVKAHLEKTCPGTVSCADIVALAARDSVSFQFQKSIWEVLTGRRDGSISRQSEALANIPSPFSSFTTLKSNFSSKGLTVQDLVVLSGAHTLGVGHCNFFSNRLYNFTGKGDSDPSLNSKYATFLKTKCRSLLDNTTTVAMDPESSLSFDTSYFVNLKEQKGMFQSDAALLTNKGASNIVDEMLISGKFFTEFAQSMKRMGAIGVLTGNSGEIRRKCSVVNS*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAACTAGCTTCTTTGATTTTCTGTTGGTGTGCTTAGTACTTTTTGGGGTTGCAGGTATTTGCCATGCAGGCGAATTAAGGAAGAATTTCTACGAGGACAGTTGCCCTCAAGCTGAG
GAGGTTATCAAGAACATCATCTGGAAACATGTAGCTAGCAATTCAGCCTTGCCTGCAAAGTTTCTAAGGATGCATTTTCATGACTGCTTTGTTAGG
GTAACAAATCTAAAATTAATGCAT
ATCTTTATGTCACAGTAGCTTGCTTCTGTGCATCTTTTAATATTTTGACAACATGTTCATTATTACGCAAGTGCTTTTATATTTATCCACATGGATAGACGCCAGACTCTTACTTTGTAA
AGTACCAATTCAGTTCATAACAAGCCAATATTCTTTCAGGGTTGTGATGCTTCATTGTTACTAAACTCTACTGCAAATAATAAAGCTGAAAAGGAAGCAGTACCAAACCTATCGGTTTCA
GGTTTTGATGTTATTGACGAGGTGAAGGCTCACCTAGAGAAGACCTGTCCTGGAACTGTTTCCTGTGCAGATATTGTTGCTTTGGCTGCTAGGGATTCTGTTTCCTTCCAA
GTAAGTTTT
AGTTACTAGTGATAAACAGAGACATGTCATAAGTCATAACTCATATGGTTCAACTTGGTTAACTTGACTTTGCTCATTGTGGTTGCAGTTCCAAAAATCAATCTGGGAAGTATTAACAGG
CAGAAGAGATGGTAGCATCTCACGACAATCGGAAGCTCTTGCTAACATACCTTCGCCTTTCTCCAGCTTCACCACTCTTAAGTCAAACTTTAGTAGCAAAGGCCTTACTGTTCAGGACCT
TGTGGTTTTGTCAG
GTATGCATTGTGAACTAAGTTGATCTAATGCCATAGTTTTCTGTTTGTCATAATCCTTTTTCATTTTACGTTTTGTTCGTGATGTATATATGTACTAAATTCGCAC
TGGCTTGTTATATGCAGGTGCACATACCCTAGGTGTGGGACATTGTAATTTTTTTAGCAACAGACTCTACAATTTTACTGGAAAAGGAGACTCGGATCCTTCCTTAAACTCAAAATATGC
AACTTTCTTAAAAACAAAATGCCGAAGTCTTTTAGACAACACCACCACAGTAGCAATGGACCCTGAAAGTTCATTATCATTTGATACTAGCTATTTTGTCAACTTGAAAGAACAAAAGGG
TATGTTTCAATCCGATGCTGCCCTTTTAACAAACAAGGGAGCATCCAACATTGTTGATGAAATGCTCATCTCTGGAAAGTTCTTTACTGAATTTGCACAATCCATGAAGAGGATGGGTGC
CATTGGAGTCCTTACTGGAAATTCTGGAGAGATTAGGAGAAAATGTAGTGTTGTTAACTCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAACTAGCTTCTTTGATTTTCTGTTGGTGTGCTTAGTACTTTTTGGGGTTGCAGGTATTTGCCATGCAGGCGAATTAAGGAAGAATTTCTACGAGGACAGTTGCCCTCAAGCTGAG
GAGGTTATCAAGAACATCATCTGGAAACATGTAGCTAGCAATTCAGCCTTGCCTGCAAAGTTTCTAAGGATGCATTTTCATGACTGCTTTGTTAGG
GGTTGTGATGCTTCATTGTTACTA
AACTCTACTGCAAATAATAAAGCTGAAAAGGAAGCAGTACCAAACCTATCGGTTTCAGGTTTTGATGTTATTGACGAGGTGAAGGCTCACCTAGAGAAGACCTGTCCTGGAACTGTTTCC
TGTGCAGATATTGTTGCTTTGGCTGCTAGGGATTCTGTTTCCTTCCAA
TTCCAAAAATCAATCTGGGAAGTATTAACAGGCAGAAGAGATGGTAGCATCTCACGACAATCGGAAGCTCTT
GCTAACATACCTTCGCCTTTCTCCAGCTTCACCACTCTTAAGTCAAACTTTAGTAGCAAAGGCCTTACTGTTCAGGACCTTGTGGTTTTGTCAG
GTGCACATACCCTAGGTGTGGGACAT
TGTAATTTTTTTAGCAACAGACTCTACAATTTTACTGGAAAAGGAGACTCGGATCCTTCCTTAAACTCAAAATATGCAACTTTCTTAAAAACAAAATGCCGAAGTCTTTTAGACAACACC
ACCACAGTAGCAATGGACCCTGAAAGTTCATTATCATTTGATACTAGCTATTTTGTCAACTTGAAAGAACAAAAGGGTATGTTTCAATCCGATGCTGCCCTTTTAACAAACAAGGGAGCA
TCCAACATTGTTGATGAAATGCTCATCTCTGGAAAGTTCTTTACTGAATTTGCACAATCCATGAAGAGGATGGGTGCCATTGGAGTCCTTACTGGAAATTCTGGAGAGATTAGGAGAAAA
TGTAGTGTTGTTAACTCTTAA

Retrieve as FASTA