Entry information : AcoPrx33 (AcoGoldSmith_v1.008421m)
Entry ID 8590
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-14 (Qiang Li)
Peroxidase information: AcoPrx33 (AcoGoldSmith_v1.008421m)
Name (synonym) AcoPrx33 (AcoGoldSmith_v1.008421m)
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx33
start..stop
S start..stop
AfpPrx20 655 0 1..326 1..326
AcoPrx31 654 0 1..326 1..326
PalPrx08 490 2e-176 9..326 5..324
CsPrx44 489 3e-176 12..326 8..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3416760..3417158 399 N° 2 3417242..3417404 163 N° 3 3417491..3417909 419  
join(3416760..3417158,3417242..3417404,3417491..3417909)


exon

Literature and cross-references AcoPrx33 (AcoGoldSmith_v1.008421m)
DNA ref. Phytozome 12:   scaffold_7 (3416760..3417909)
Protein sequence: AcoPrx33 (AcoGoldSmith_v1.008421m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (301)
PWM (Da):   %s   35478.91 (32617.4) Transmb domain:   %s   i7-24o
PI (pH):   %s   7.68 (7.31) Peptide Signal:   %s   cut: 26 range:26-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKGFCTYIVLPLYLLLTLATISVHGQGTSVGFYKITCPQVESIVSKTVQSHFSSDPSIAPGLLRMHFHDCFVQGCDASILIAGRNTEKTAGPNLLLRGYDVIDDAKKQLEAACPGVVSCADILALAARDSVVATRGASWQVPTGRRDGRVSLDSDTSNLASFTDSIDVQKQKFSAKGLDTKDLVALVGAHTIGTSACQFFRYRLYNFTTTGPDSTIDPSFLPRLQALCPPNGDGSRRVSLDTDSQNRFDTSFFTNLRNGRGILESDQKLWTDTSTQPFVQRFEGPIRGLLGLRFDFEFGNSMVKMSNIEVKTGTQGEIRSVCSAIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGGGTTTTGCACCTACATTGTTCTTCCTCTTTATCTCCTGCTTACCTTGGCTACCATCTCTGTTCATGGACAGGGAACTAGTGTTGGGTTTTACAAAATAACATGCCCACAAGTC
GAATCCATTGTTAGTAAGACAGTGCAATCCCATTTCAGTTCAGATCCTTCCATCGCTCCAGGGTTGCTTAGAATGCACTTTCATGACTGCTTTGTTCAAGGGTGTGATGCATCTATTCTT
ATTGCTGGACGTAACACAGAGAAAACTGCAGGACCTAATCTTTTGTTAAGGGGATACGACGTAATTGATGATGCCAAAAAACAACTTGAAGCTGCATGTCCCGGAGTAGTATCTTGTGCT
GATATTCTTGCTTTAGCTGCAAGAGATTCAGTGGTTGCG
GTAAGTGCTAAAAATATAATATTGACAGAACTAAAATACTAAACCAAATATATATACTAATGGATGTACATTAATTCTTGC
AGACTCGTGGAGCAAGTTGGCAAGTGCCGACTGGGCGTAGAGATGGGCGTGTCTCATTGGATAGCGATACTTCTAATCTTGCTAGTTTCACTGACTCCATCGATGTACAGAAGCAGAAAT
TTTCAGCCAAGGGACTTGACACTAAGGATCTTGTGGCACTAGTTG
GTAAATTTTGAAGACCTTAATAGCCAATAGTAATTAAAGGTTTAGGCTCTATATTTAACTAATATATACTGTGAA
TTTGTTATTAGGAGCACATACCATTGGGACTTCAGCTTGCCAATTCTTCAGGTACAGACTATACAACTTCACAACAACCGGTCCAGACAGCACAATCGACCCTTCTTTTCTTCCTCGATT
ACAAGCTCTTTGTCCACCCAACGGTGATGGAAGCAGGCGCGTCTCACTAGACACTGACAGCCAGAATAGATTCGACACTTCATTCTTTACAAACTTGAGGAATGGAAGGGGAATACTTGA
ATCTGACCAGAAATTATGGACTGATACTTCCACACAACCATTTGTACAACGCTTTGAAGGTCCCATTAGAGGTTTACTTGGGTTGAGGTTTGATTTTGAGTTTGGAAATTCAATGGTGAA
GATGAGTAATATAGAAGTGAAGACTGGTACACAAGGCGAAATTCGCAGTGTTTGTTCTGCTATTAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGGGTTTTGCACCTACATTGTTCTTCCTCTTTATCTCCTGCTTACCTTGGCTACCATCTCTGTTCATGGACAGGGAACTAGTGTTGGGTTTTACAAAATAACATGCCCACAAGTC
GAATCCATTGTTAGTAAGACAGTGCAATCCCATTTCAGTTCAGATCCTTCCATCGCTCCAGGGTTGCTTAGAATGCACTTTCATGACTGCTTTGTTCAAGGGTGTGATGCATCTATTCTT
ATTGCTGGACGTAACACAGAGAAAACTGCAGGACCTAATCTTTTGTTAAGGGGATACGACGTAATTGATGATGCCAAAAAACAACTTGAAGCTGCATGTCCCGGAGTAGTATCTTGTGCT
GATATTCTTGCTTTAGCTGCAAGAGATTCAGTGGTTGCG
ACTCGTGGAGCAAGTTGGCAAGTGCCGACTGGGCGTAGAGATGGGCGTGTCTCATTGGATAGCGATACTTCTAATCTTGCT
AGTTTCACTGACTCCATCGATGTACAGAAGCAGAAATTTTCAGCCAAGGGACTTGACACTAAGGATCTTGTGGCACTAGTTG
GAGCACATACCATTGGGACTTCAGCTTGCCAATTCTTC
AGGTACAGACTATACAACTTCACAACAACCGGTCCAGACAGCACAATCGACCCTTCTTTTCTTCCTCGATTACAAGCTCTTTGTCCACCCAACGGTGATGGAAGCAGGCGCGTCTCACTA
GACACTGACAGCCAGAATAGATTCGACACTTCATTCTTTACAAACTTGAGGAATGGAAGGGGAATACTTGAATCTGACCAGAAATTATGGACTGATACTTCCACACAACCATTTGTACAA
CGCTTTGAAGGTCCCATTAGAGGTTTACTTGGGTTGAGGTTTGATTTTGAGTTTGGAAATTCAATGGTGAAGATGAGTAATATAGAAGTGAAGACTGGTACACAAGGCGAAATTCGCAGT
GTTTGTTCTGCTATTAATTAG

Retrieve as FASTA